Search Article Keyword  
PubMed Submission Abstarct PDF Cited  Click Count: 1727 DownLoad Count: 259 

ISSN 1007-9327 CN 14-1219/R  World J Gastroenterol  2000; October 6(5):738-741

Transfusion transmitted virus infection in general populations and patients with various liver diseases in south China

Yong Peng Chen, Wei Fang Liang, Lian Zhang, Hai Tang He and Kang Xian Luo


Yong Peng Chen, Wei Fang Liang, Lian Zhang, Hai Tang He and Kang Xian Luo  Department of Infectious Disease, Nanfang Hospital, the First Military Medical University, Guangzhou 510515, Guangdong Province, China
Dr. Yong Peng Chen, graduated with a bachelor degree in 1993, and with a master degree in 1999 in the First Military Medical University, majoring in infectious diseases as a lecturer, with 8 papers published.
Supported by Science Fund of Military Medical Science for the Ninth Five-Year Key Research, No.98Z073
Correspondence to:
Prof. Kang Xian Luo, Department of Infectious Disease, Nanfang Hospital, the First Military Medical University, Tonghe Town of Baiyun Borough, Guangzhou 510515, Guangdong Province, China
Telephone: 0086-20-85141946, 87636914, Fax. 0086-20-87636914
Email. heplab@fimmu.edu.cn
Received: 2000-04-24 Accepted: 2000-05-12

Subject headings: transfusion-transmitted virus; liver disease /etiology; DNA virus; polymerase chain reaction; serodiagnosis; hepatitis viruses

Chen YP,Liang WF, Zhang L, He HT, Luo KX. Transfusion transmitted virus infection in general populations and patients with various liver diseases in south China. World J Gastroentero,2000;6(5):738-741

INTRODUCTION
Although several specific detecting methods had been applied to determine the he patitis virus, there was a lot of cryptogenic hepatitis without any known hepatitis infectious marker[1]. The prevalence of hepatitis G virus (HGV) (also known as GB-C virus) infection has been reported to be 5%-13% in patients with non-A-E hepatitis and cirrhosis, however, there is little evidence suggesting that HGV causes hepatitis in human[2-6]. Although cryptogenic liver diseases are almost certainly related to a variety of etiologi es, one or more as-yet-unidentified infectious agents are likely to account for a proportion of these cases.
     
In December 1997, a novel DNA virus was reported by Nishizawa et al[7] to be associated with elevated aminotransferase levels in patients with post-transfusion hepatitis of unknown etiology (non-A-G hepatitis). This virus was designated transfusion transmitted virus (TTV). Then, Luo et al[ 8]and Wei et al[9]also detected TTV in the sera of patients from an outbreak of crypto genic hepatitis in south China. And TTV was also detected in patients with post transfusion hepatitis in China[10].In subsequent analyses, TTV is an un-enveloped single-stranded DNA virus for which a sequence of 3800 bases was determined[11]. Evidence of potential hepatotropism of TTV was reported with TTV DNA detected in liver tissue[12 ]. Histopathological study indicated that the characteristics of liver histology of TTV infected patients are portal inflammation and interlobular bile duct damage[13]. TTV was proposed as the part of causative agent of non-A to G hepatitis. Seroepidemiological studies have shown TTV to have global distribution[12,14,15]. Although the potential association of TTV with cryptogenic hepatitis is intriguing, the pathological and clinical significance of this virus remains to be established. To assess more thoroughly the etiological role of TTV in the causation of hepatitis, we determined the frequency of TTV infections and their relationship to liver disease in several cohorts of liver diseases and rural population.

PATIENTS AND METHODS
Rural population
Nighty males and 89 females aged from 1 to 73 years were from a natural village with total population of 190 in southeast of Yunnan Province. Among them, 90 persons were of nationality of Han, others of Yi.

Patients with cryptogenic hepatitis
Forty-four patients with cryptogenic hepatitis were admitted in hospital between January 1993 and May 1999, with negative assays for sera marker of hepatitis virus A-E, and also negative assays for anti-nuclear antibody, anti-smooth muscle antibody, EB virus antibody, CMV antibody and anti-mitochon drial antibody. Part of patients were confirmed with liver biopsy suggestive of acute hepatitis.

Patients with HBV related chronic liver diseases
The prevalence of TTV infection was also determined in five cohorts of HBV related chronic liver disease:
HBsAg asymptomatic carrier (AsC) (n=52); Chronic hepatitis B (CHB) (n=46); Chronic hepatic failure (n=40); Active liver cirrhosis (n=39); Hepatocyte carcinoma (HCC) (n=21). The diagnosis accorded with diagnostic criterion of viral hepatitis in the Fifth Science Meeting of Infectious Disease and Verminosis (Beijing, 1995)[16].

Nested PCR for the detection of TTV DNA
Evidence for TTV infection was determined by detection of TTV DNA by nested PCR. Nucleic acids were extracted from 100
μL serum. TTV DNA was determined by PCR with nested primers described by Okamoto et al [11] that sensitively detect TTV DNA, irrespective of different genotypes, as well as by Ampli-Taq- DNA Polymerase. In brief, the first round of PCR was performed with RD038 primer (sense: 5
-TGA CTG TGC TAA AGC CTC TA-3) and NG059 (antisense: 5-ACA GAC AGA GGA GAA GGC AAC ATG-3) for 35 cycles (94, 45 seconds; 54, 45 seconds; 72, 60 seconds [additional 7 minutes for the last cycle]), and the second-round PCR was performed with NG061 (sense: 5-GGC AAC ATG TTA TGG ATA GAC TGG-3) and NG063 (antisense: 5-GAC CGT AAA ATG GTA AAG GTT TCA-3) for 35 cycles with the same conditions. The size of the second-round PCR was 271bp. The amplicons were electrophoresed in 2% agarose gel, stained with ethidium bromide, and photographed under ultraviolet light. All assays were performed in an amplicon free work area. Positive and negative results were confirmed with repeated assays.

Direct sequencing of the amplicons
Direct sequencing of the amplicons was carried out by Cybersyn.

Statistical analysis
Prevalence of TTV infection (as measured by TTV DNA detectable in serum by PCR) in rural population and several cohorts of liver disease was determined. Data analysis was carried out using
χ2 test. And the liver function test of chronic hepatitis B was analysed using t test.

RESULTS
Sequencing of the amplicons (Figure 1)
TTV G1b: GGCAACATGTTATGGATAGACTGGCTAAGCAAAAAAAACATGAACTATGACAAAGTA
SERA: CAAAGTAAATGCTTA A TATCAGACCTACCTCTATGGGCAGCAGCATATGGATATGTAG G
AATTTTGTGCAAAAAGTACAGGAGACCAAAACATACACATGAATGCCTGGCTACTAAT A
AAGAAGTCCCTTTACAGACCCACAACTACTAGTACACACAGACCCCACAAAAGGCTTT G C
GTTCCTTACTCTTTAAACTTTGGAAATGGTAAAATGCCAG

Figure 1(PDF) Comparison of nucleic acids sequence bet ween TTV G1b and amplicons and nucleic acids sequence nt1935-2205 of TTV G1b, sera amplicons had a homogeneity of 98.5%, suggesting the presence of TTV DNA in sera.

Prevalence of TTV infection (Table 1)
Table 1
Prevalence of TTV infection among study cohorts

Groups

TTV positive rate (n)

TTV negative rate (n)

Total

Rural population

10.61(19)

89.39(160)

179

Cryptogenic hepatitisa

38.63(17)

61.37(27)

44

HBsAg asymptomatic carrier

9.62 (5)

90.38(47)

52

Chronic hepatitis Bb

15.22 (7)

84.78(39)

46

HBV related active liver cirrhosisc

22.5 (9)

77.5(31)

40

HBV related hepatic failured

23.08 (9)

76.92(30)

39

Hepatocyte carcinomae

9.52 (2)

90.48(19)

21

Total

16.15(68)

83.85(353)

421

aχ2=20.486, P0.005 vs rural population; bχ2=0.713, P0.25 vs HBsAg asymptomatic carrier; cχ2=0.749, P0.25 vs chronic hepatitis B; dχ2=0.853, P0.25 vs chronic hepatitis B; eχ2=0.000, P0.9 vs HBsAg asymptomatic carrier.

Rural population
Ninteen of 179 (10.61%) unselected healthy peoples were detected TTV DNA positive. The prevalence of TTV infection was inde pendent of sex, age and nationality (Table 2).

Table 2
The prevalence of TTV infection in a natural village in Yunnan Province, regarding of sex, nationality and age

Result

Sexa

Nationalityb

Agec

Male

Female

Total

Han

Yi

Total

14

14-55

55

Total

TTV positive

7

12

19

8

11

19

5

13

1

19

TTV negative

83

77

160

82

78

160

47

102

11

160

Total

90

89

179

90

89

179

52

115

12

179

Prevalence(%)

7.8

13.5

10.6

8.9

12.4

10.6

9.6

11.3

8.3

10.6

aχ2=1.535, P0.2bχ2=0.568,P0.4cχ2=0.178,P0.9.

Patients with cryptogenic hepatitis
The prevalence of TTV infection in patients with cryptogenic hepatitis was 38.63% (17 of 44). Two of the TTV-infected patients with fulminant hepatic failure, while the others with mild hepatitis.

Patients with HBV related chronic liver disease
The prevalence of TTV infection of AsC, CHB, ALC, CHF and HCC was 9.62%(5/4 7), 15.22%(7/39), 22.5%(9/31), 23.08%(9/30) and 9.52%(2/19), respectively. It seemed that the state of illness was related with the co-infec tion of TTV. However, there was no statistical difference between the prevalences (Table 1).

Effect on liver function test of TTV co-infection
While co-infected with TTV, the state of illness did not exacerbate in patients with CHB (Table 3). In patients with active liver cirrhosis and chronic hepatic failure, there were no significant differences in results of laboratory tests in patients with and without TTV DNA (P
0.2) whereas the co-infection of TTV increased the mortality of patients with hepatic failure (P=0.038).

Table 3
Effect on liver function test of TTV co-infection in patients with chronic hepatitis B

Liver function test

TTV negative

TTV positive

t value

P value

ALT(U/L)

347.0±286.5

282.3±230.2

0.523

0.5

AST(U/L)

199.9±171.8

140.8±105.3

0.742

0.2

Protein A/G

1.24±0.28

1.26±0.12

0.140

0.5

TBil(μmol/L)

34.1±30.6

22.8±9.3

0.883

0.2

Prothrombin (s)

17.7±5.5

15.6±1.53

0.783

0.2

DISCUSSION
The recent discovery in Japan by Nishizawa et al[7] of a novel parenterally transmissible, unenveloped, single-stranded DNA virus (TTV) in patients with non-A-G posttransfusion hepatitis had raised some important questions about TTV as a potential cause of liver disease.
     
Previous study indicated that TTV infection was common in healthy individuals, blood donors, HBsAg AsC, patients on hemodialysis and patients with various liver diseases, however played a minimal role on liver disease[17-26]. Another paper suggested TTV may cause chronic hepatitis in a limited number of patients, but remains dormant most of the time[27]. In our study, we found 10.61% of healthy individuals with normal liver function test were infected with TTV, and the prevalence was independent of sex, age and nationality. The result indicated TTV infection was common in healthy individua ls. However, frequency of TTV infection in patients with cryptogenic hepatitis was significantly higher. As evidence of potential hepatotropism of TTV had been reported with TTV-DNA titers shown to be 10 to 100 folds greater in liver tissue than in serum[11,12], TTV would account for part of the reason for patients with cryptogenic hepatitis. As we know that there are many HBsAg AsC, whereas HBV causes many hepatitises. This study suggested that the majority of individuals with TTV could be asymptomatic carriers, with only a small proportion of carriers actually developing hepatitis.
      Generally, co-infection of hepatitis virus would lead to exacerbation of hepat itis. While co-infected with hepatitis A and B virus, patients encountered exac erbation of illness, with more severe abnormal results of laboratory tests and higher mortality[28]. In histopathological evaluation, co-infection of hepatitis virus had no significant difference in development of liver cirrhos is[29]. Previous study indicated that superinfection of TTV does not exe rt deleterious effects on the liver disease induced by HCV. Triple infection, HCV and TTV plus HBV or HGV, did not cause severe liver disease[27].In current study, prevalence of TTV infection in HBsAg AsC and patients with chronic hepatitis B, HBV related liver cirrhosis and chronic hepatic failure was 9.62%, 15.22%, 22.5% and 23.08% respectively. There was no significant difference among prevalence of TTV infection, suggesting the minor effect on liver disease of co-infection of TTV. The comparison of levels of ALT, AST, total bilirubin, A/G of serum protein and prothrombin time between TT virus-positive and-negative patients did not show any differences, as accorded with another report[30]. However, TTV co-infection increased the mortality of patients with hepatic failure.
      Most cases of chronic hepatitis, cirrhosis, and HCC in developed countries are caused by HBV or HCV infections and heavy alcohol intake. A relatively small proportion of liver diseases is of unknown etiology. The recently discovered HGV seems to have no actual role in causing acute or chronic liver disease[31 ], whereas the role of the more recently discovered TTV is still to be define d. To inquire the relationship between TTV infection and HCC, we investigated the prevalence of TTV infection in HBV infected patients with HCC, and compared with HBsAg AsC. The result indicated similar prevalence in both cohorts (9.52% vs 9.62%, P
0.9), which did not support the hypothesis of an association between TTV infection and HCC, and accorded with previous studies[32,33]. Another report indicated that TTV was not specific for HBV-negative and HCV-negative patients with HCC. For all TTV-positive patients, the TTV genome was not integrated into host hepatocyte DNA[34] . In conclusion, TTV was common in general population and several cohorts of liver disease. Though the majority of individuals with TTV could be asymptomatic carriers, TTV would account for part of cryptogenic hepatitis. As TTV co-infec tion did not affect the state of HBV infection, further study on pathogenic effect on liver disease of TTV infection should be continued.

REFERENCES
1    Kodali VP, Gordon SC, Silverman AL, McCray DG. Cryptogenic liver dise ase in the United States: further evidence for 
      non A, non B and non-C hepatitis.Am J Gastroenterol,1994;89:1836-1840
2    De Filippi F, Romeo R, Rumi MG, Donato MF, Del Ninno E, Colombo M. Low prevalence of HGV RNA in Italian patients 
      with non A-E chronic hepatitis. Hepatology,1996;24:499A
3    Yamashita K, Oketani M, Oketani K, Yamauchi K, Sho Y, Arima T, Mawatari F, Hasegawa S, Komorizono Y, Ishimaru K,
      Inshibashi K, Miyazaki H, Arima T. Cryptogenic severe chronic liver diseases in South Japan.Hepatology,1996;24:600A
4    Hamid S, Jafri W, Khurshid M, Jarvis L, Shah H, Abbas Z, Sultana T, Siddiqui AA, Khan H, Simmonds P. Hepatitis G in 
      the developing world: impact of HGV on liver disease in Pakistan.Hepatology,1996;24:520A
5    Aikawa T, Sugai Y, Okamoto H. Hepatitis G infection in drug abusers with chronic hepatitis C.N Engl J 
      Med,1996;334:195-196
6    Alter HJ, Nakatsuji Y, Melpolder J, Wages J, Wesley R, Shih JWK, Kim JP. The incidence of transfusion associated 
      hepatitis G virus infection and its relation to liver disease.N Engl J Med,1997;336:747-754
7    Nishizawa T, Okamoto H, Konishi K, Yoshizawa H, Miyakawa Y, Mayumi M. A novel DNA virus (TTV) associated with 
      elevated transaminase levels in posttransfusion hepatitis of unknown etiology.Biochem Biophys Res 
      Commun,1997;241:92-97
8    Luo KX, Zhang L, Wang SS, Nie J, Ge Y, Chen ZY, Yu SY, Liu YY, Yang SC, Liang WF, He HT, Jiao CS. An outbreak of 
      enteric transmitted non A, non E viral hepatitis: primary study of clinical epidemiology and virology.
      Zhonghua Ganzangbing Zazhi,1998;6:161-163
9    Wei LP, Liao DX, Liang WF. Investigation of an outbreak of new type of hepatitis in Gaoming of Guangdong Province.
      Shijie Huaren Xiaohua Zazhi,1999;7:175-176
10  Yang SS, Wu CH,Chen TH, Huang YY, Huang CS. TT viral infection through blood transfusion: retrospective investigation
      on patients in a prospective study of post transfusion hepatitis.World J Gastroentero,2000;6:70-73
11  Okamoto H, Nishizawa T, Kato N, Ukita M, Ikeda H, Iizuka H, Miyakawa Y, Mayumi M.Molecular cloning and 
      characterization of a novel DNA virus (TTV) associated with posttransfusion hepatitis of unknown etiology.Hepatol Res, 
      1998;10:1-16
12  Xu DJ, Lang ZW, Wang GY, Yan HP, Xu RP, Li DF, Zhou YS, Wang HT. Detec tion of TTV DNA in liver tissue of patients 
      with non A-G hepatitis. Zhonghua Ganzangbing Zazhi,1999;7:96-98
13  Ge Y, Ren XF, Li DZ, Hu TH, Yang Q. Liver histologic characteristics of patients with TTV infection during an epidemic of
      TTV infection in Wuhan.Shijie Huaren Xiaohua Zazhi,1999;7:1029-1030
14  Naoumov NV, Petrova EP, Thomas MG, Williams R. Presence of a newly des cribed human DNA virus (TTV) in patients 
      with liver disease. Lancet,1998;352:195-197
15  Charlton M, Adjei P, Poterucha J, Zein N, Moore B, Therneau T, Krom R, Wiesner R. TT virus infection in North 
      American blood donors, patients with fulminant hepatic failure,and cryptogenic cirrhosis.Hepatology,1998;28:839-842
16  Protocol of prevention and treatment for viral hepatitis. Zhonghua Chuanranbing Zazhi,1995;13:241-246
17  Chen TY, Zhang SL. Prognosis in TTV studies.Shijie Huaren Xiaohua Zazhi,1999;7:420-421
18  Fu EQ, Bai XF, Pan L, Li GY, Yang WS, Tang YM, Wang PZ, Sun JF. Investigation of TT virus infection in groups of 
      defferent people in Xi
an.Shijie Huaren Xiaohua Zazhi,1999;7:967-969
19  Yu JG,Han JJ, Xiao DM, Yin YM, Shang QH, Zhou XM, Du QL, Zhang GS. Investigation of TTV infection and partial 
      sequence analysis of TTV DNA in Shandong.Shijie Huaren Xiaohua Zazhi,2000;8:352-354
20  Yang J, Wang YC, Zhang HY, Li HM. TTV infection in various kind of populations in China.
      Shijie Huaren Xiaohua Zazhi,1999;7:497-498
21  Chen XJ, Peng XM, Gao ZL, Lu JX, Yao JL. The significance of TTV infection in normal population and patients liver
      diseases.Shijie Huaren Xiaohua Zazhi,1999;7:5-7
22  Huang CH, Zhou YS, Chen RG, Xie CY, Wang HT. The prevalence of transfusion transmitted virus infection in blood 
      donors. World J Gastroentero,2000;6:268-270
23  Kao JH, Chen W, Hsiang SC, Chen PJ, Lai MY, Chen DS. Prevalence and implication of TT virus infection: minimal role 
      in patients with non A-E hepati tis in Taiwan.J Med Virol,1999;59:307-312
24  Forns X, Hegerich P, Darnell A, Emerson SU, Purcell RH, Bukh J. High prevalence of TT virus (TTV) infection in patients
      on maintenance hemodialysis: frequent mixed infections with different genotypes and lack of avidence of associated 
      liver disease.J Med Virol,1999;59:313-317
25  Abe K, Inami T, Asano K, Miyoshi C, Masaki N, Hayashi S, Ishikawa KI, Takebe Y, Win KM, El Zayadi AR, Han KH, 
      Zhang DY. TT virus infection is widespr ead in the general populations from different geographic regions.
      J Clin Microbiol,1999;37:2703-2705
26  Hsieh SY, Wu YH, Ho YP, Tsao KC, Yeh CT, Liaw YF. High prevalence of TT virus infection in healthy children and adults 
      and in patients with liver disease in Taiwan.J Clin Microbiol,1999;37:1829-1831
27  Ikeuchi T, Okuda K, Yokosuka O, Kanda T, Kobayashi S, Murata M, Hayash i H, Yokozeki K, Ohtake Y, Kashima T, Irie Y.
      Superinfection of TT virus and hep atitis C virus among chronic haemodialysis patients.
      J Gastroenterol Hepatol, 1999;14:796-800
28  Keeffe EB. Is hepatitis A more severe in patients with chronic hepatit is B and other chronic liver diseases.
      Am J Gastroenterol,1995;90:201-205
29  Colombari R, Dhillon AP, Piazzola E, Tomezzoli AA, Angelini GP,Capra F, Tomba A, Scheuer PJ. Chronic hepatitis in 
      multiple virus infection: histopathological evaluation.Histopathology,1993;22:319-325
30  Hayashi K, Fukuda Y, Hayakawa T, Kumada T, Nakano S. TT virus (TTV) infection in patients with acute hepatitis.
      Nippon Rinsho,1999;57:1322-1325
31  Theodore D, Lemon SM. GB virus C, hepatitis G virus, or human orphan flavivirus. Hepatology,1997;25:1285-1286
32  Tagger A, Donato F, Ribero ML, Binelli G, Gelatti U, Portera G, Albert ini A, Fasola M, Chiesa R, Nardi G, Study BH. 
      A case control study on a novel DNA virus (TT virus) infection and hepatocellular carcinoma.Hepatology,
      1999;30:294-299
33  Shimizu T, Moriyama M, Matsumura H, Arakawa Y. TT virus infection in patients with hepatocellular carcinoma 
      associated with non A to G hepatitis: histopathological study. Nippon Rinsho,1999;57:1381-1386
34  Yamamoto T, Kajino K, Ogawa M, Gotoh I, Matsuoka S, Suzuki K, Moriyama M, Okubo H, Kudo M, Arakawa Y, Hino O.
      Hepatocellular carcinomas infected with the novel TT DNA virus lack viral integration. Biochem Biophys Res 
      Commun,1998;251:339-343

 

Reviews Add
more>>


Related Articles:
more>>