Fen Huang, Gui-Zhen Zhao, Yeng Li, The Department of Infectious Diseases, The Second Affiliated Hospital of China Medical University, Shenyang 110003, Liaoning Province, China
Dr Fen Huang, female, born in 1962-10-06 in Shenyang, Liaoning Pr ovince, Han nationality, graduated from China Medical University in 1985 and got master degree from CMU in 1991, now Associated Professor, majoring in pathogene sis and therapy of viral hepatitis, having 20 papers published.
Correspondence to: Dr. Fen Huang, Department of Infectious Disea ses, The Second Affiliated Hospital of China Medical University, 36 block 1, San Hao Street, He-Ping District, Shenyang, Liaoning, 110003, China
Telephone: +86-24-23893501·961, Fax. +86-24-23892617
Received: 1999-07-03 Accepted: 1999-09-18

Subject headings: hepatitis C; hepatitis C virus; genotyping

Huang F, Zhao GZ, Li Y. HCV genotypes in hepatitis C patients and their clinical significances. World J Gastroentero, 1999;5(6):547-549

INTRODUCTION
It has been discovered that hepatitis C virus (HCV) presents considerable nucleotide variation and has many genotypes. At least twelve, 5 of which prevalent, i.e.: Ⅰ/1a, Ⅱ/1b, Ⅲ/2a, Ⅳ/2b, and Ⅴ/3a types. The different genotypes of HCV may possess some retationship with regional distr ibution, clinical manifestation, response to treatment and prognosis of HCV infe ction, thus to study the genotypes of HCV further in different areas is of pract ical value. We detected HCV genotypes in 94 patients with hepatitis C and in 6 p atients with primary hepatocarcinoma by PCR assay with four kinds of type-speci fic primers with a view to study the distribution of HCV genotypes in hepatitis C in Shenyang area and their clinical significances.

MATERIALS AND METHODS
Patients
One hundred serum samples with positive anti-HCV and HCV RNA were received from patients who were in clinic or in ward of our department from July 1993- June 1 996. Among the 94 patients with hepatitis C, there were 9 acute hepatitis, 73 ch ronic hepatitis (50 mild degree, 14 moderate and 9 severe ones), 12 active posth epatitic cirrhosis. Mean age 38.8 years ±15.6 years, male 77 and female 17. Forty-nine of them (52.1%) had history of blood or blood product transfusion. Superinfection or coinfection with B hepatitis was excluded, 2 cirrhosis were confirmed pathologically after operation. Six patients with primary hepatocarcin oma were diagnosed by serum AFP, B-ultrasound, CT and MRI. One had surgical bio psy.

HCV genotyping primers
HCV genotyping primers in core region were synthesized by the Bioengineering Research Center in Shanghai of Chinese Academy of Sciences.The nucleotide sequences of primers were as follows: universal primers: P₁ sense 5′ CGCGCGACTAGGAAGACTTC 3′ (nt 139-158); P₂ antisense 5′ ATGTACC CCATGAGGTCGCT 3′ (nt 391-410), type specific primers: P₃ sense 5′ AGGAA GACTTCCGAGCGGTC 3′ (nt 148-167); P₄ antisense 5′TGCCTTGGGGATAGGCTGAC 3 ′ (nt 185-204) (HCV-Ⅰ); P₅ antisense 5′ GAGCCATCCTGCCCACCCCA 3′ (nt 2 72-291) (HCV-Ⅱ); P₆ antisense 5′ CCAAGAGGGAC GGGAACCTC 3′ (nt 302-321) (HCV-Ⅲ); P₇ antisense 5′ ACCCTCGTTTCCGTACAGAG 3′ (nt 251-270) (HCV-Ⅳ ).

Methods
Serum HCV RNA was extracted using one-step method of guanidinium thiocyanate. F or detecting HCV genotypes, Okamoto′s^［1］ method was used but modified. Major procedures were: ① reverse transcription and first PCR amplification: in extracted RNA, we added 5 units of avian myeloblastosis virus reverse transcript ase (AMV-RT) (Promega), 20 units of inhibitor of RNAase (RNasin) (Promega), 2U Taq enzyme (Promega), 2mM dNTP 3μL, 10×AMV- RT buffer 3μL and universal primers (P₁,P₂) 0.8μmol/L. Total volume was 30μL.After reverse transcription at 42℃ for 20min, first PCR was performed for 35 cycles. Each cycle included denaturation at 94℃ for 1min, annealing at 55℃ for 1.5min and extension at 72℃ for 2min. ② The second PCR amplification: in 5μL products of the first PCR, we added 3μL 10×AMV-RT buffer, 2mM dNTP 3μL, 2U Taq enzyme and 0.8μmol/L of typ e-specific primers (P₃,P_4,5,6,7). Total volume was 30μL. PCR conditions were: denaturation at 94℃ for 1min, annealing at 60℃ for 1min, extension at 72℃ 1.5min, for 30 cycles, then another extension at 72℃ for 5min. In every amplification, positive control of HCV RNA serum and negative control of normal blood sample were provided. ③ Ten microliters produ cts of the second PCR were subjected to electrophoresis on 6% polyacrylamide gel, stained with ethidium bromide, and observed under ultraviole t ray. Each HCV genotype was characterized by different nucleotide lengths: 57bp for type Ⅰ, 144bp for type Ⅱ, 174bp for type Ⅲ and 1.23 bp for type Ⅳ.

RESULTS
One hundred serum samples were genetically classified into 3 types: type Ⅱ in 5 8 samples (58%), type Ⅲ in 27 (27%) and mixed type (Ⅱ/Ⅲ) in 14 (14%), o nly 1 sample (1%) remained unclassified (Figure 1).

Figure 1 The results in HCV genotyping.1,6: Ⅱ/Ⅲ mixed type. 2: HCV-Ⅱ genotype. 3: Negative control. 4,5: HCV-Ⅲ genotype. 7: Φx 174 DNA/Hae Ⅲ marker.

      In 94 patients with hepatitis C, the distribution of HCV genotypes in patients with hepatitis C was not identical. The data were analyzed with R×C Table test, χ²=28.9, P＜0.01. In acute hepatitis, in mild, moderate and severe chronic hepatitis, cirrhosis, the infectious rates of type Ⅱ were 55.6%, 36.0%, 71.4%, 88.9% and 91.7%, respectively, but those of type Ⅲ were 22.2%, 46.0%, 7.14%, 0% and 8.3%, respectively. In moderate an d severe chronic hepatitis and cirrhosis, the proportion of type Ⅱ was signific antly elevated in comparison with that in mild chronic hepatitis (P＜0.05 or P＜0.01), but the proportion of type Ⅲ was significantly lower t han that in mild ones (P＜0.05). Six patients with hepatocarcinoma were all infected by genotype Ⅱ HCV(Table 1). The genotype distribution of HCV in post-transfusional and sporadic hepatitis C was identical. The results were analyzed with R×C Table χ² test, χ²=3.74, P＞0.05(Table 2).

DISCUSSION
There are some differences in distribution of HCV genotypes in different regions. In America, infection of HCV-Ⅰ genotype is predominated, but in China and Ja pan, HCV-Ⅱ genotype is dominant over HCV-Ⅲ genotype. Du et al^［2］ reported that infection by type Ⅱ was predominant in Beijing, Wuhan, Guangzhou, Xi＇an, Chongqing, Guangxi areas. Among these areas the highest infection rate of type Ⅲ was in Beijing (19%), the infection rates of mixed type Ⅱ/Ⅲ were the highest in Guangzhou (9%). Our study showed in Shenyang that the infection rate of type Ⅱ (58%) ＞type Ⅲ (27%) and mixed type Ⅱ/Ⅲ (14%), the latter two were higher in Shen yang than those in other parts of China. Therefore, future prevention and treatment strategy sh ould be directed towards type Ⅱ HCV mainly, but not neglecting type Ⅲ and type Ⅱ/Ⅲ. In our study, no HCV-Ⅰ and HCV-Ⅳ were found. One serum sample was positive for HCV RNA by repeated PCR assay, but it could not be classified a fter the two tests, indicating there might be other HCV genotype in our area.
      Clinical manifestations of hepatitis C infected by HCV type Ⅱ are usually more severe, those of HCV type Ⅲ are milder. The HCV genotypes seem to be closely related to the clinical condition and degree of severity of hepatitis C. All our 6 patients with hepatoca rcinoma were found to carry HCV type Ⅱ which indicated that infection of type Ⅱ may be related to occurrence of hepatocarcinoma^［3］.

Table 1 HCV genotypes of hepatitis C and hepatocarcinoma

^aP＜0.05, ^bP＜0 .01, compared with mild chronic hepatitis, by x² test.
Table 2 HCV genotypes of post-transfusional and sporadic hepatitis C

No significant difference was found in the distribution of HCV genotypes in post -transfusional and sporadic hepatitis C, showing HCV genotypes may be not relat ed to routes of infection. The infection rate (20.9%) of mixed type(Ⅱ/Ⅲ) in post-transfusional hepatitis was higher than that in sporadic hepatitis (9.8%), indicating repeated blood or blood product transfusion may be contributory.

REFERENCES
1    Okamoto H, Sugiyama Y, Okada S, Kurai K, Akahane Y, Sugai Y, Tanaka T, Sato K, Tsuda F, Miyakawa Y, Mayumi M.
      Typing hepatitis C virus by polymerase chain reaction with type specific primers: application to clinical surveys and
      tracing infectious sources. J Gen Virol, 1992;73:673-679
2    Du SC, Tao QM, Zhu L, Liu JX, Wang H, Sun Y. Genotyping study of hepatitis C virus by restriction fragment length
      polymorphsim in its 5′NC region.Zhonghua Yixue Zazhi, 1993;1:7-9
3    Yang JM, Liu WW, Luo YH. Genotypic investigation of hepatitis C virus in patient with primary hepatic carcinoma, liver
      cirrhosis and hepatitis. Zhonghua Chuanranbing Zazhi, 1995;1:1-3 

Reviews	Add
more>>