Search Article Keyword  
PubMed Submission Abstarct PDF Cited  Click Count: 2194 DownLoad Count: 813 

ISSN 1007-9327 CN 14-1219/R  World J Gastroenterol  1999; December 5(6):470-476

Characterization of six tumor suppressor genes and microsatellite instability in hepatocellular carcinoma in southern African blacks

Martins C, Kedda MA, Kew MC


Martins C, Kedda MA, Kew MC, MRC/CANSA/University Molecular Hepatology Research Unit, Department of Medicine, University of the Witwatersrand Medical School, 7 York Road, Parkto wn 2193, Johannesburg, South Africa.
Supported in part by grants/bursaries from the University of the Witwatersrand, and the Foundation for Research Development, Pretoria, South Africa
Correspondence to:
Professor M.C. Kew, Department of Medicine, Medical School, 7 York Road, Parktown, 2193, Johannesburg, South Africa.
Telephone: +27(0)11 488 3626, Fax. +27(0)11 643 4318
Email:014anna
chiron.wits.ac.za
Received: 1999-08-10

Subject headings: carcinoma, hepatocellular; southern African b lacks; cumulative LOH; tumor suppressor genes; microsatellite genomic instabilit y; liver neoplasms

Martins C, Kedda MA, Kew MC. Characterization of six tumor suppressor genes and microsatellite instability in hepatocellular carcinoma in southern African blacks. World J Gastroentero, 1999;5(6):470-476

Abstract
AIM: To analyse cumulative loss of heterozygosity (LOH) of ch romosomal regions and tumor suppressor genes in hepatocellular carcinomas (HCC s) from 20 southern African blacks.

METHODS: p53, RB1, BRCA1, BRCA2, WT1 and E-cadherin- ge nes were analysed for LOH, and p53 gene was also analysed for the codon 249 mutation, in tumor and adjacent non-tumorous liver tissues using molecular tech niques and 10 polymorphic microsatellite markers.

RESULTS: p53 codon 249 mutation was found in 25% of the subj ects, as was expected, because many patients were from Mozambique, a country wit h high aflatoxin B1 exposure. LOH was found at the RB1, BRCA2 and WT1 loci in 20%(4/20) of the HCCs, supporting a possible role of these genes in HC C. No LOH was evident in any of the remaining genes. Reports of mutations of p 53 and RB1 genes in combination, described in other populations, were not confirmed in this study. Change in microsatellite repeat number was noted at 9 /10 microsatellite loci in different HCCs, and changes at two or more loci w ere detected in 15%(3/20) of subjects.

CONCLUSION: We propose that microsatellite/genomic instability may play a role in the pathogenesis of a subset of HCCs in black Africans.

INTRODUCTION
The evolution of cancer is thought to occur from the stepwise accumulation of ge netic aberrations in the same cell. These include loss of function of tumor supp ressor genes, activation of proto-oncogenes, faulty DNA mismatch repair, and th e integration of viral DNA
12. Hepatocellular carcinoma (HCC) is a le ading cause of death in both Africa and the Far East, resulting in at least 310000 deaths worldwide each year3. HCC is multifactorial in aet iology and its pathogenesis is complex. The major risk factors involved in the development of the tumor are chronic HBV and HCV infections, cirrhosis and aflatoxin B1 (AFB) exposure4,5.
      Heavy dietary AFB intake is thought to cause a guanine (G) to thymine (T) transversion at the third base of codon 249 of the p53 gene, and for this reason clustering of this point mutation occurs in HCCs from Africa and China
6-8. In addition, other mutations in, or deletions of, the p53 gene (on chromosome 17p13.1) are found with relatively high frequency in human HCCs in other countries. The functional loss of this tumor suppressor gene, as well as its abnormal expression, have been proposed to play a significant role in HCC development9 or at least in the development of a subset of HCCs. The majority of p53 alterations reported to date have loss of one allele accompanied by mutations of the second allele10. Abnormalities of the p53 gene, such as gene mutation, deletion, or the nuclear accumulation of mutant p53 protein have also been found to correlate with increased allelic loss at the Breast Cancer Susceptibility Gene 1 (BRCA1) locus (17q21). This gene is thought to encode a transcription factor which acts as a tumor suppressor11. LOH of the BRCA1 gene in HCC was reported in a Korean study12. The Breast Cancer Susceptibility Gene 2 (BRCA2) (13q12-13) product is thought to be a tumor suppressor13 involved in cellular proliferation and differentiation14, and may be involved in the development of HCC15. LOH at the BRCA2 locus has been reported in HCC15,16 and it has been suggested that mutations of the BRCA2 gene may be involved in hepatocarcinogenesis15. The retinoblastoma (RB1) gene (13q14.2) product (pRB) functions as a cell cycle regulator17, and its absence leads to unrestricted cell growth. Although there is no definite evidence that mutations of the RB gene are involved in HCC, LOH of the RB1 gene has been documented in human HCCs18,12. LOH of WT1 and 11p13 have been reported in human HCCs12,16. WT1 appears to be involved in proliferation, differentiation and apoptosis19,20. The product of the E-cadherin (Uvomorulin) gene (16q221) is the primary adhesion molecule in epithelium21. Loss of function of E-cadherin may lead to decreased cell-cell adhesion22, cellular phenotypic changes, and the development of invasive properties23. In HCC, multicentric development and the formation of intrahepatic metastases is common24. LOH on chromosome 16q has been previously reported to be important in the initiation or progression of HCC25,26.
      Polymerase chain reaction (PCR) amplification of microsatellites (sequences uniformly distributed throughout the human genome) provides a simple and effective method of rapidly detecting loss of heterozygosity/microsatellite instability (LOH/MI)27. Microsatellite instability is defined as the loss or gain o f microsatellite repeats at 2 or more loci and is detected by the presence of extra bands or band shifts between tumor and non-tumorous tissue DNA.
      In this study, we examined the G-T transversion at codon 249 of the p53 gene, LOH of the p53, RB1, BRCA1, BRCA2, WT1 and E-cadherin genes, and micr osatellite instability at 10 loci flanking these genes, in HCC and adjacent non -tumorous liver, from 20 southern African blacks.

MATERIALS AND METHODS
Subjects
The subjects included 20 southern African black men, aged between 20 and 40 years. HCC tissue and matched non-tumorous liver were obtained at necropsy or durin g surgical resection. DNA was extracted from the tissues using a modified “salt ing-out” procedure
28.

HBV markers
The HBV status of the subjects was determined previously using commercially available kits to detect HBV markers in serum (Abbott Labs, Chicago, IL, USA).

LOH and microsatellite instability
Microsatellite instability (MI) and loss of heterozygosity (LOH) studies were carried out by PCR and gel electrophoresis using polymorphic repeat markers (Table 1).
      PCR products of the polymorphic loci p53, D17S846 and RB1.20 were resolved on 4% composite agarose gels, while radioactively labeled PCR products of the remaining loci were resolved on polyacrylamide gels, and viewed by autoradiography. Band mobility shifts between tumor and matched non-tumorous liver DNA wer e scored as a change in allele repeat number. LOH was characterized by the disappearance of one band or a considerable (80%) decrease in band intensity in heterozygotes, whilst microsatellite instability was determined by expansion and/or contraction of microsatellite sequences.

PCR for LOH and MI
A standard PCR protocol (primers, Table 1) was followed for the p53, WT1, D1 3S137, RB(1.20), D13S120, D13S127, D17S855, and D17S846 loci. Each PCR reaction consisted, at final volume, of 100ng DNA, 1U Taq DNA polymerase (Prom ega, Madison, USA), 1×buffer, 1mM each dATP, dTTP, dGTP, 0.1mM d CTP, 0.025μCi α32 P dCTP, and 50pmol of each pr imer; in a total volume of 50μL, amplification for 30 cycles of denaturation at 94
for 30s, annealing 55 for 30s, extension at 72 for 1min, and a final cycle of 72 for 10 minutes.
      The PCR reaction for the D16S301 and D16S260 loci (primers, Table 1) consisted, at final volume, of 100ng DNA, 1U Taq- DNA Polymerase, 1×buffer, 0.1 % gelatin, 1mM each dGTP, dATP, dTTP, 0.1mM dCTP, and 0.025μCi α 32P dCTP, 50pmol of each primer; in a total volume of 25μL, amplification for 25 cycles of denaturation at 94 for 1min, annealing at 55 for 2min, extension at 72 for 2.5min, and a final cycle of 72 for 10 minutes.

p53 codon 249 mutation
The p53 codon 249 mutation was detected by PCR-RFLP using primer sequences F3 and R3 (Table 1), and confirmed by sequence analysis. The PCR reaction consis ted of, at final volume
6, 100ng DNA, 2.5U of Taq-DNA polymerase (Promega), 1×buffer, 1mM MgCl2, 0.8mM each of dCTP, dATP, dGTP, dTTP, and 50pmol of each primer; in a total volume of 50μL, amplification for 30 cycles of denaturation at 94 for 15s, annealing at 56 for 15s, and extension at 72 for 30s. The 110bp PCR product was sized on ethidium bromide stained agarose gels against a 100bp DNA ladder (Promega). A G to T transversion at the third base of codon 249 was detected by the presence or absence of a Hae restriction site6.All samples shown by digestion to have the codon 249 mutation were sequenced in both directions both upstream and downstream in separate reactions, to confirm the presence of the mutation.

Table 1
PCR primers

Gene/Locus

Primer

Primer sequence

Amplicon

Amplicon length

p53

p53F3

5GTTGGCTCTGACTGT-ACCAC

exon 7 spanning codon 2496

110bp

 

p53R3

5CTGGAGTCTTCCAGT-GTGAT

 

 

p53

p53ivs1a

5GCACTTTCCTCAACTCTACA

ALU sequence within intron 1

200bp-300bp

 

p53ivs1b

5AACAGCTCCTTTAATGGCAG

of p53 gene43

 

D13S120

1353L

5ATGACCTAGAAATGATACTGGC

(AC)73repeat at D13S12044

112bp-136bp

(BRCA2)

1353R

5CAGACACCACAACACACATT

 

 

D17S846

FF

5TGCATACCTGTACTACTTCAG

(GGAA)25 repeat a t D17S84645

250bp-300bp

(BRCA1)

RF

5TCCTTTGTTGCAGATTTCTTC

 

 

D17S855

FS

5GGATGGCCTTTTAGAAAGTGG

AC repeat at D17S85546

145bp

(BRCA1)

RS

5ACACAGACTTGTCCTACTGCC

 

 

WT1

400

5AATGAGACTTACTGGGTGAGG

AC repeat within 3 untranslated

100bp-200bp

 

401

5TTACACAGTAATTTCAAGCAACGG

sequence of WT3347

 

RB1

B57

5TGTATCGGCTAGCCTATCTC

CTTT(T)n (n=14-26) repeat

400bp-600bp

 

B103

5AATTAACAAGGTGTGGTGGT

within intron 20 of RB gene48,49

 

D13S127

1341L

5CAGATATGTACTCATGCACATG

(AC)35 repea t at D13S12744

130bp-142bp

(BRCA2/RB1)

1341R

5AAACAAATGAGTTTGGCTGT

 

 

D13S137

F

5TTTCCTCATTCTTTCCCAATTG

(GT)22 repeat at D13S13750

±135bp

(RB1)

R

5CAGGAGGGATGGACTCACTTC

 

 

E-cadherin

E-cadF1

5GATCCTAAGGACAAATGTAGATGCTCT

D16S301 locus polymorphic

146bp

 

E-cadF1

5AGCCACTTCCCAGAACTTGGCTTCC

AC region51

 

E-cadherin

E-cadF2

5GGTTGAGATGCTGACATGC

D16S260 locus polymorphic

±234bp

 

E-cadR2

5CAGGGTGGCTGTTATAATG

AC repeat region52

 

Note: WT1: Wilms tumor gene; RB1: Retinoblastoma gene; BRCA1: Brea st cancer susceptibility gene 1; BRCA2: Breast cancer susceptibility gene 2; bp: base pairs.

Sequencing
All sequencing was carried out using the Sequenase PCR Product Sequencing Kit (United States Biochemical Corp., Cleveland, Ohio), according to the manufacture r
s instructions.

RESULTS
HBV status
Seven patients were currently infected with HBV (5 of these were HBsAg-positive ; HBeAg-negative; the HBeAg status of the remaining 2 was unknown), and 6 were previously infected (anti-HBc and anti-HBs-positive). The HBV status of the remaining patients was not known (Table 2).

LOH/MI analyses
LOH was noted for the WT1 (1/13 subjects), RB (1.20) (1/10 subjects), D13S120 (1/20 subjects) and D13S127 (2/14 subjects) loci (Table 2).
      The D13S137 and D13S127 loci flank the RB1 gene, while the RB (1.20) repeat sequence is within intron 20 of the same gene. LOH at the D13S127 locus suggests loss of at least a portion of the RB1 gene as shown in 2/14 informative subjects. LOH at RB (1.20) indicated loss of the RB1 gene in a further 1/ 10 informative subjects. The RB1 gene was thus lost in 3/18 informativ e subjects (Table 2). LOH at the D13S120 and D13S127 loci flanking the BRC A2- gene was shown in 2/20 informative subjects (Table 2). No LOH was found for any of the remaining loci (Table 2).
      Microsatellite/genomic instability (or a gain/loss of microsatellite repeats ) was found in 15% (3/20) of subjects.

p53 gene codon 249 analysis
The p53 codon 249 mutation was detected in 25% of the subjects using PCR-RFLP analysis, and confirmed by sequencing. The p53 codon 249 mutation was det ected in the tumor tissue of 3 subjects, in the non-tumorous liver of 1 subject , and in both the tumor and non-tumorous liver tissue of 1 subject (Table 2) .
      Sequencing gel electrophoresis of the p53 gene product revealed a gel artifact, in all subjects with wild-type chromosomes, previously described by Kapelne r et al(1994).
      All tumors were at an advanced stage. No attempt was made to correlate the presence of LOH or microsatellite instability with clinical or other features.

Table 2
LOH, SSCP and sequence analysis

Subject number

VNTRs

p53 codon 249

HBV
status

p53

WT1

RB1

BRCA2

BRCA1

E cadherin

(ALU)

(AC)

D13S137
(GT)2 2

RB1.20CTTT(T)n

D13S120
(AC)73

D13S12
7(AC)35

D17S85
5(AC)

D17S846
(GGAA)25

D16S301
(AC)

D16S260
(AC)

T

NT

1

NI

NI

-

-

-

NI

-

-

-

NI

-/-

-/-

HBsAg+; HBeAg-

2

-

-

-

-

-

NI

-

-

-

NI

-/-

-/-

HBsAg+

3

-

-

-

-

-

-

-

-

NI

-

+/-

-/-

HBsAg+; HBeAg-

4

-

-

-

NI

-

-

?

NI

-

-

-/-

-/-

anti-HBc+; anti-HBs+

6

-

?

?

?

-

NI

?

-

?

-

+/-

-/-

HBsAg+; HBeAg-

7

?

?

?

?

-

-

?

?

-

-

-/-

-/-

anti-HBs+; anti-HBc+

8

NI

+

-

+/-

-/-

anti-HBs+; anti-HBc+

14

-

NI

?

NI

-

+

-

?

?

NI

-/-

-/-

anti-HBs+; anti-HBc+

16

?

?

?

+

+

?

?

-/-

-/-

HBsAg+

18

+

?

?

-

?

?

?

-/-

-/-

HBsAg+; HBeAg-

24

NI

-

NI

-

-

-

-

-

NI

-

-/-

+/-

anti-HBs+; anti-HBc+

39

-

NI

-

?

-

-

-

NI

?

-

-/-

-/-

HBsAg+; HBeAg-

40

NI

-

?

-

-

NI

-

-

?

-

-/-

-/-

anti-HBs+; anti-HBc+

48

NI

-

-

-

-

-

-

-

?

?

-/-

-/-

?

50

NI

-

-

NI

-

-

-

NI

-

NI

-/-

-/-

?

51

NI

-

?

NI

-

NI

-

-

-

-

-/-

-/-

?

52

NI

-

NI

-

-

NI

-

-

-

-

+/-

-/-

?

53

-

-

-

-

-

-

-

-

NI

-

-/-

-/-

?

54

-

?

-

-

-

-

-

-

-

NI

-/-

-/-

?

56

NI

-

-

NI

-

-

-

NI

NI

NI

-/-

-/-

?

Note: LOH: loss of heterozygosity; -: HBV status-negative for particular antigen/antibody, mutation studies-mutation absent; LOH studies: no LOH;p53 codon 249 mutation analysis: GT transversion absent; +: HBV status-positive for particular antigen/ antibody, mutation studies mutation present, LOH studies: LOH, p53 codon 249 mutation analysis: GT transversion present; ?: results not obtained because of unsuccessful PCR or HBV status unknown; : a change in repeat number between tumor (T) and non-tumorous liver (NT) in both chromosomes; /: an increase/decrease in repeat number between tumor (T) and non-tumorou s liver (NT) in one chromosome; NI: not informative; VNTRs: Variable number of tandem repeat sequences; HBV: Hepatitis B virus; WT1: Wilms tumor gene; RB1: Retinoblastoma gene; BRCA1: Breast cancer susceptibility gene 1; BRCA2: Breast cancer susceptibility gene 2; HBsAg: hepatitis B virus S antigen; HBeAg: hepatitis B virus E antigen; anti-HBs: antibody to hepatitis B virus S antigen; anti-HBc: antibody to hepatitis B virus C antigen

DISCUSSION
LOH of the p53 gene has been reported with relatively high frequency in HCCs from Japan (29%-69%)
29,30, and also from southern Africa (60%), an d Taiwan (39.3%)6,31. No LOH was detected for p53 in this study, although inactivation/reduction of p53 gene expression or of its product by means other than LOH may have occurred in our population. In a study by Walker et al (1991), p53 allele loss occurred only in HBV-negative tumors. It thus appeared as if a mechanism other than loss of one p53 allele and mutati on of the second allele was operating in HBV-positive tumors, thereby eliminati ng fully functional p53 protein. The obvious mechanism would be the formation of complexes between wild-type p53 protein and viral protein/s leading to the loss of function of wild-type p53 protein. Such associations have been well docume nted in the literature32. In our study most samples were HBV positive and a mechanism such as that mentioned above, rather than p53 gene inactivat i on by physical mutation and LOH, may have been operating in our tumors to elimin ate the function of the p53 protein. Alternatively, should both alleles of t he p53 gene be mutated in ways other than LOH in our samples, such as point mutations and small deletions (50bp)18, these would not have been de tected by the techniques employed in this study.
      The p53 codon 249 mutation was detected in 25% (5/20) subjects. This was e xpected as the subjects were southern African blacks, some of whom came from Moz ambique and other areas where aflatoxin exposure is prevalent. The p53 codon 249 mutation was found in both tumor and non-tumorous liver tissues of one sub ject. This could have been caused by contamination of the non-tumorous liver wi th tumor tissue. In another subject the mutation was detected in the non-tumor ous liver only. The presence of this mutation has been documented in non-tumoro us liver and not in the corresponding tumor tissues
33, where it was pr op osed that normal liver subjected to prolonged aflatoxin exposure could gradually accumulate high levels of AGT mutations, whereas the mutation would not necess a rily arise in neoplastic populations that were cloned from single progenitor cel ls resistant to aflatoxin. Unfortunately, insufficient tissue was available in t hese two patients for histopathological examination, so we cannot exclude microscopic contamination as a cause of this finding in the two subjects. Two patients with a codon 249 GT transversion were HBsAg positive, 2 subjects were anti-H Bs/anti-HBc positive and the HBV status of 1 subject was unknown. This concur red with previous studies where mutations at codon 249 were not found in non-HB V-related HCCs34, and is in agreement with previous work which sugges ts that both aflatoxin exposure and HBV infection are required for this mutation to occur29,33.
      A gel artefact generated by formation of a mini hairpin secondary structure in the codon 249 region of the p53 gene in 34 wild type chromosomes, lead to a “missing” G at the third base of codon 249 in the sequence of the sense strand
35. In a study by Kapelner et al (1994), as with our samples, Hae- digest confirmed the presence of the recognition sequence GGCC. However, since there has been no other report of this “G deletion” in such a commonly sequenced region, Kapelner et al (1994) suggested that this artifact may not occur often.
      LOH appears to have occurred in 4 subjects at the RB1 (3/18 ro 17%), BRCA2 (2/20 or 10%) and WT1 (1/13 or 8%) loci (2 of these subjects had LO H at both the RB1 and BRCA2 genes). Although reduction to homozygosity h as been apparent in certain individuals, and has consistently been scored as LOH , ‘band disappearance’ may also be caused by a gain/loss in microsatellite repeats. We think, however, that this is unlikely to be the case in so many indiv iduals.
      LOH of the retinoblastoma gene has been documented in 33% of HCCs from Korea
12, 16%-73% of HCCs from Japan18,30and 27% of HCCs from Austra lia36. One copy of the RB1 gene was lost in 17% (3/18) of HCCs i n this study. Although our sample is small, this frequency differs from the high er percentages found thus far. This may reflect population differences, LOH of t he RB1 gene may play a role in a small subset of southern African HCCs. Coin cident mutation of the p53 and RB1 genes has been observed in 25%1 8, and 12.9%37 of advanced HCCs in Japan and Australia respective ly36. Mutations and LOH in these genes is most frequently observed in advanced stage HCCs, like those investigated here. However, no coincident mutati on of these genes was detected in this study.
      LOH of the BRCA2 gene has been reported in 3% of Japanese HCCs
15, and in 40% of HCCs from the USA16. In this study one copy of the BRCA2 gene was lost in 10% (2/20) HCCs. This finding supports the notion that BRCA2 may function as a tumor suppressor gene in the liver15, and that it may in some way be involved in the progression of a small number of HCCs . To our knowledge, LOH of the BRCA1 gene has been reported only once, in a study in which 11.5% (3/6) of HCCs showed LOH at this locus12. No LOH was found for this gene in our sample population. LOH at 11p13, the region c ontaining the WT1 gene, as well as LOH of the gene itself has been reported in 4%-7% HCCs12,16. Our result of 8% (1/13) LOH agrees with these findings. LOH of the region where the E-cadherin gene is located (16q22) ha s been reported in 64%-91% of Chinese and Japanese HCCs25,26. No LOH w as found for this gene in our study. Although all the HCCs used in this study we re in advanced stages, it was not established whether they were highly undiffere nti ated. There may be retention of E-cadherin expression in these samples and no loss of intercellular adhesiveness.
      We cannot say whether HBV played any role in the chromosome losses reported here
37. Cumulative LOH is thought to reflect the sequential development of HCC progression.
      LOH of a number of tumor suppressor genes may be important in the advancement of HCC
37. Frequent loss of tumor suppressor genes has been reported in Korean HCCs, where 86% HCCs had LOH of 1 gene, and 59% had LOH of 2-4 genes12. Piao et al (1997), investigated 10 tumor suppressor genes (-VHL, APC, EXT1, WT1, RB1, p53, BRCA1, nm23, DPC4, DCC). The genes most often lost were p53 (66%), RB1 (33%), EXT1 (33%), and APC (20%). The genes found to be lost most often in our study were RB1 (17%) and BRCA2 (10%). However, as the total LOH of the p53, RB1, BRCA1, BRCA2, WT1 and E-cadhe rin genes in this study was 20% (4/20), we conclude that LOH of tumor suppre ssor genes is infrequent in our HCCs.
 Microsatellite/genomic instability is reflected in the expansion/contraction of microsatellite sequences, and is thought to be a product of replication errors
38. Microsatellite instability has been considered to be insignificant in HCC development by some authors, while others believe that it may be signifi cant39. To our knowledge, this is the first time microsatellite instab ility has been looked at in HCCs from a southern African black population. It is important to note that there are differences in allele frequency between our so uthern African Negroid population and the Asian, European and Australian populat i ons, characterized previously at the WT1, D13S137, D13S120, D13S127, D17S855 , D16S301, and D16S260 loci (paper in preparation). Microsatellite instability h as been documented in 40% of HCCs from the USA39, and in 41% of HCCs a t two or more loci in a French study40. In a Korean study microsatelli te instability was detected in 4/10 (40%) HCCs, where each subject showed inst ability at two or more loci39. Of the 9 markers used in their study, 3 showed genetic instability in one or more subjects. In our study 3/20 (15%) H CCs showed instability at two or more loci. Of the 10 loci investigated, 9 showe d genetic instability in one or more subjects. Cumulative microsatellite in stability indicates advanced HCC. One of these subjects also had the codon 249 m utation in the p53 gene. We were not able to determine whether joint changes at the loci were necessary for tumor development, or whether they represented i ndependent events in tumor initiation and/or progression. Microsatellite/ genomic instability is believed to occur at random and may reflect alteration of the entire genome of the cancer cell41. The order of these changes is most likely insignificant. Their cumulative effect however, may be important 42. We propose that microsatellite/genomic instability may play a ro le only in a small subset of HCC in our population.
      In conclusion, our observations support a possible role of p53, WT1 and BRCA2 genes in the pathogenesis of HCC, and that microsatellite instability appears to be an important factor contributing to HCC development in a subset of our HCCs.

REFERENCES
1    Yee CJ, Roodi N, Verrier CS, Parl FF. Microsatellite instability and loss of heterozygosity in breast cancer.
      Cancer Res, 1994;54:1641-1644
2    Fujimoto Y,Kohgo Y.Alteration of genomic structure and/or expression of cancer associated genes in hepatocellular
      carcinoma.Abstract in English, article in Japanese. Rinsho Byori, 1998;46:9-14
3    Parkin DM, Stjernsw rd J, Muir C. Estimates of the worldwide frequency of twelve major cancers.
      Bull WHO, 1984;62:163-182
4    Harris CC. Hepatocellular carcinogenesis:recent advances and speculations.Cancer Cells, 1990;2:146-148
5    Saito I,Miyanmura T,Ohbayashi A,Harada H, Katayama T, Kikuchi S, Watanabe Y, Koi S, Onji M, Ohta Y, Choo QL,
      Houghton M, Kuo G. Hepatitis C virus infection is associated with the development of hepatocellular carcinoma.
      Proc Natl Acad Sci USA, 1990;87:6547-6549
6    Bressac B, Kew M, Wands J, Ozturk M. Selective G to T mutations of p53 gene in hepatocellular carcinoma from 
      southern Africa. Nature, 1991;350:429-431
7    Hsu IC, Metcalf RA, Sun T, Welsh JA, Wang NJ, Harris CC. Mutational hotspot in the p53 gene in human hepatocellular
      carcinomas. Nature, 1991;350:427-428
8    Scorsone KA, Zhou YZ, Butel JS, Slagle BL. p53 mutations cluster at codon 249 in hepatitis B virus positive hepatocellular
      carcinomas from China. Cancer Res, 1992;52:1635-1638
9    Bressac B, Galvin KM, Liang TJ, Isselbacher KJ, Wands JR, Ozturk M. Abnormal structure and expression of p53 gene in
      human hepatocellular carcinoma. Proc Natl Acad Sci USA, 1990;87:1973-1977
10  Nigro JM, Baker SJ, Preisinger AC, Jessup JM, Hostetter R, Cleary K, Bigner S, Davidson N, Baylin S, Devilee P, Glover T,
      Collins F, Weston A, Modali R, Harris C, Vogelstein B. Mutations in the p53 gene occur in diverse human tumor types.
      Nature, 1989;342:705-708
11  Smith SA, Easton DF, Evans DGR, Ponder BAJ. Allele losses in the region 17q12 21 in familial breast and ovarian cancer
      involve the wild-type chromosome. Nature Genet, 1992;2:128-131
12  Piao Z, Kim H, Jeon B, Lee WJ, Park C. Relationships between loss of heterozygosity of tumor suppressor genes and
      histologic differentiation in hepatocellular carcinoma. Cancer, 1997;80:865-872
13  Gudmundsson J, Johannesdottir G, Bergthorsson JT, Arason A, Ingvarsson S, Egilsson V. Different tumor types from
      BRCA2 carriers show wild-type chromosome deletions on 13q12-13.Cancer Res, 1995;55:4830-4832
14  Rajan JV, Marquis ST, Gardner HP, Chodosh LA. Developmental expression of BRCA2 colocalizes with BRCA1 and is
      associated with proliferation and differentiation in multiple tissues. Dev Biol, 1997;184:385-401
15  Katagiri T, Nakamura Y, Miki Y. Mutations in the BRCA2 gene in hepatocellular carcinomas. Cancer Res, 
      1996;56:4575-4577
16  Wang HP, Rogler CE. Deletion in human chromosome arms 11p and 13q in primary hepatocellular carcinomas.
      Cytogenet Cell Genet, 1988;48:72-78
17  Hsia CC, Di Bisceglie AM, Kleiner DE Jr., Farshid M, Tabor E. RB tumor suppressor gene expression in hepatocellular
      carcinomas from patients infected with the hepatitis B virus. J Med Virol, 1994;44:67-73
18  Murakami Y, Hayashi K, Hirohashi S, Sekiya T. Aberrations of the tumor suppressor p53 and retinoblastoma genes in
      human hepatocellular carcinomas. Cancer Res, 1991;51:5520-5525
19  Evans RM, Hollenberg SM. Zinc fingers: gilt by association. Cell,1988;52:1-3
20  Menke AL, Shvarts A, Riteco N, Van Ham RCA, Van Der Eb AJ, Jochemsen AG. Wilms
tumor 1 Kts isoforms induce p53
      independent apoptosis that can be partially rescued by expression of the epidermal growth factor receptor or the
      insulin receptor. Cancer Res, 1997;57:1353-1363
21  Shimoyama Y, Hirohashi S, Hirano S, Noguchi M, Shimosato Y, Takeichi M, Abe O. Cadherin cell adhesion molecules in
      human epithelial tissues and carcinomas. Cancer Res, 1989;49:2128-2133
22  Takeichi M. Cadherins: a molecular family important in selective cell cell adhesion. Ann Rev Biochem, 1990;59:237-252
23  Behrens J, Mareel MM, Van Roy FM, Birchmeier B. Dissecting tumor cell invasion: epithelial cells acquire invasive 
      properties after the loss of uvomorulin-mediated cell-cell adhesion. J Cell Biol, 1989;108:2434-2447
24  Nagao T, Inoue S, Yoshimi F, Sodeyama M, Omori Y, Mizuta T, Kawano N, Morioka Y. Postoperative recurrence of
      hepatocellular carcinoma. Ann Surg, 1990;211:28-33
25  Slagle BL, Zhou YZ, Birchmeier W, Scorsone KA. Deletion of the E-cadherin gene in hepatitis B virus positive Chinese
      hepatocellular carcinomas. Hepatology, 1993;18:757-762

26  Tsuda H, Zhang W, Shimosato Y, Yokota J, Terada M, Sugimura T, Miyamura T, Hirohashi S. Allele loss on chromosome
      16 associated with progression of human hepatocellular carcinoma. Proc Natl Acad Sci USA, 1990;87:6791-6794
27  Weissenbach J, Gyapay G, Dib C, Vignal A, Morissette J, Millasseau P, Vaysseix G, Lathrop M. A second generation
      linkage map of the human genome. Nature, 1992;359:794-801
28  Miller S, Dykes D, Polesky H. A simple salting out procedure for extracting DNA from human nucleated cells.
      Nuc Acids Res, 1988;16:1215
29  Oda T, Tsuda H, Scarpa A, Sakamoto M, Hirohashi S. p53 gene mutation spectrum in hepatocellular carcinoma.
      Cancer Res, 1992;52:6358-6364
30  Fujimoto Y, Hampton LL, Wirth PJ, Wang NJ, Xie JP, Thorgeisson SS. Alterations of tumor suppressor genes and allelic
      losses in human hepatocellular carcinomas in China. Cancer Res, 1994;54:281-285
31  Slagle BL, Zhou Y Z, Butel JS. Hepatitis B virus integration event in human chromosome 17p near the p53 gene identifies
      the region of the chromosome commonly deleted in virus positive hepatocellular carcinomas.Cancer Res,1991;51:49-54
32  Wang XW, Forrester K, Yeh H, Feitelson MA, Gu JR, Harris CC. Hepatitis B virus X protein inhibits p53 sequence-specific
      DNA binding, transcriptional activity, and association with transcription factor ERCC3.
      Proc Natl Acad Sci USA, 1994;91:2230-2234
33  Kirby GM, Batist G, Fotouhi Ardakani N, Nakazawa H, Yamasaki H, Kew M, Cameron RG, Alaoui-Jamali MA. Allele-specific
      PCR analysis of p53 codon 249 AGT transversion in liver tissues from patients with viral hepatitis.Int J Cancer, 
      1996;68:21-25
34  Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 mutations in human cancers. Science, 1991;253:49-53
35  Kapelner SN, Turner RT, Sarkar G, Bolander ME. Deletion mutation can be an unsuspected gel artifact.
      Biotechniques, 1994;17:64-66
36  Walker GJ, Hayward NK, Falvey S, Graham W, Cooksley WGE. Loss of somatic heterozygosity in hepatocellular carcinoma.
      Cancer Res, 1991;51:4367-4370
37  Yumoto Y, Hanafusa T, Hada H, Morita T, Ooguchi S, Shinji N, Mitani T, Hamaya K, Koide N, Tsuji T. Loss of 
      heterozygosity and analysis of mutation of p53 in hepatocellular carcinoma. J Gastroenterol Hepatol, 1995;10:179-185
38  Gao X, Zacharek A, Salkowski A, Grignon DJ, Sakr W, Porter AT, Honn KV. Loss of heterozygosity of the BRCA1 and other
      loci on chromosome 17q in human prostate cancer. Cancer Res, 1995;55:1002-1005
39  Kazachkov Y, Yoffe B, Khaoustov VI, Solomon H, Klintmalm GB, Tabor E. Microsatellite instability in human hepatocellular
      carcinoma: relationship to p53 abnormalities. Liver, 1998;18:156-161
40  Salvucci M, Lemoine A, Azoulay D, Sebagh M, Bismuth H, Reyns M, May E, Debuire B. Frequent microsatellite instability in
      post hepatitis B viral cirrhosis. Oncogene, 1999;13:2681-2685
41  Li C, Larsson C, Futreal A, Lancaster J, Phelan C, Aspenblad U, Sundelin B, Liu Y, Ekman P, Auer G, Bergerheim USR.
      Identification of two distinct deleted regions on chromosome 13 in prostate cancer. Oncogene, 1998;16:481-487
42  Butel JS,Lee TH,Slagle BL. Is the DNA repair system involved in hepatitis B-virus mediated hepatocellular carcinogenesis.
      Trends Microbiol, 1996;4:119-124
43  Futreal PA, Barrett JC, Wiseman RW. An ALU polymorphism intragenic to the TP53 gene. Nuc Acids Res, 1991;19:6977
44  Bowcock A, Osborne Lawrence S, Barnes R, Chakravarti A, Washinton S, Dunn C. Microsatellite polymorphism linkage
      map of human chromosome 13q. Genomics, 1993;15:376-386
45  Fletjer WL, Kukowska latallo JF, Kiousis S, Chandrasakharappa SC, King SE, Chamberlain JS. Tetranucleotide repeat
      polymorphism at D17S846 maps within 40kb of GAS at 17q12.22. Hum Molec Genet, 1993;2:1
46  Anderson LA, Friedman L, Osborne Lawrence S, Lynch E, Weissenbach J, Bowcock A, King MC. High density genetic map
      of the BRCA1 region of chromosome 17q12 q21. Genomics, 1993;17:618-623
47  Haber DA, Buckler AJ, Glaser T, Call KM, Pelletier J, Sohn RL, Douglass EC, Housman DE. An internal deletion within an
      11p13 Zinc finger gene contributes to the development of Wilm
s tumor. Cell, 1990;61:1257-1269
48  Henson JW, Schnitker BL, Correa KM, von Deimling A, Fassbender F, Xu HJ, Benedict WF, Yandell DW, Louis DN. The
      retinoblastoma gene is involved in malignant progression of astrocytomas. Ann Neurol, 1994;36:714-721
49  Yandell DW, Dryja TP. Detection of DNA sequence polymorphisms by enzymatic amplification and direct genomic 
      sequencing. Am J Hum Genet,1989;45:547-555
50  Petrukhin KE, Speer MC, Cayanis E, Bonaldo MF, Tantravahi U, Soares MB,Fischer SG, Warburton D, Gilliam C, Ott J.
      A microsatellite genetic linkage map of human chromosome 13. Genomics, 1993;15:76-85
51  Thompson AD, Shen Y, Holman K, Sutherland GR, Callen DF, Richards RI. Isolation and characterization of (AC)n
      microsatellite genetic markers from human chromosome 16. Genomics, 1992;13:402-408
52  Weber JL,Kwitek AE, May PE. Dinucleotide repeat polymorphisms at the D16S260, D16S261,D16S265,D16S266,and
      D16S267 loci.Nuc Acids Res,1990;18:4034
 

 

Reviews Add
more>>


Related Articles:
more>>