Shao-Geng¹ Zhang, Meng-Chao² Wu, Jing-Wang¹ Tan, Han² Chen, Jia-Mei² Yang and Qi-Jun² Qian, ¹The Department of Hepatobiliary Surgery, Fuzhou Military General Hospital, Fuzhou 350025, Fujian Province, China
²Shanghai East Hepatobiliary Hospital of Second Military Medical University, Shanghai 200433, Shanghai, China
Dr. Shao-Geng Zhang, male, born on 1964-02-16 in Nanchang city, Jian gxi Province, graduated from Shanghai Second Military Medical University in 1997 , under the instruction of professor Meng-Chao Wu, he was engaged in the studie s of liver transplantation and obtained M.D. and Ph.D. Now he is working in the Department of Hepatobiliary Surgery, Fuzhou Military General Hospital.
Supported by the National Natural Science Foundation of China, No. 39500152
Correspondence to: Dr. Shao-Geng Zhang, Department of Hepatobil iary Surgery, Fuzhou Military General Hospital, 156 Xi Huan Bei Road, Fuzhou 350 025, Fujian Province, China
Telephone: +86-591-3709089
Received: 1999-02-05

Subject headings: liver transplantation; immunosuppression; pe rforin granzyme B genes; graft rejection

Zhang SG, Wu MC, Tan JW, Chen H, Yang JM, Qian QJ. Expression of perforin and granzyme B mRNA in judgement of immunosuppression effect in rat liver transplantation. World J Gastroentero, 1999;5(3):217-220

Abstract
AIM: To explore the expression of perforin and granzyme B gen es mRNA to judge the effect of immunosuppression in acute rejection of liver transplantation.

METHODS: The expression of perforin and granzyme B genes mRNA was examined by reverse transcription polymerase chain reaction (RT-PCR) in ha mster to rat liver grafts under the immunosuppression of cyclosporine or/and spl enectomy. Histological findings were studied comparatively.

RESULTS: Cyclosporine could obviously decrease the cellular in filtration, and completely repress the expression of mRNA for perforin and granz yme B, but could not change severe hepatocyte necrosis and hemorrhage. Splenecto my could significantly lighten hepatocyte necrosis, and completely eliminate he morrhage, but not affect the cellular infiltration and the expression of perfori n and granzyme B genes mRNA. Cyclosporine or splenectomy alone could not prolon g the survival time, however, their combination could completely repress the rej ection of liver grafts. The survival time of animals were significantly prolonge d (37.1 days). The architecture of hepatic lobules was preserved. There were sl ight cellular infiltration in the portal tracts and no expression of perforin an d granzyme B genes mRNA could been seen in three weeks after transplantation.

CONCLUSION: Perforin and granzyme B genes are valuable in judg ing the effect of immunosuppression in liver transplantation.

INTRODUCTION
Rejection is one of major factors influencing the outcome of the patients after liver transplantation, and acute rejection is more harmful to the grafts and recipients. The cellular immunity has been proved to be a chief mechanism in rejecting liver transplantation, and cytotoxic T lymphocyte (CTL) is the major effector cell, the perforin lytic pathway to granzyme B, plays a critical role in the T-cell immun e response^［1］. It is a hot issue of the moment to search for special ear ly markers to judge the effect of immunosuppression in acute rejection of liver transplantation. In this study, the expression of perforin and granzyme B mRNA was examined by reverse transcriptase polymerase chain reaction (RT-PCR) under the immunosuppression of Cyclosporine (CsA) and splenectomy based on the establishment of a stable and reliable model of hamster to rat concordant xenogeneic orthotopic liver transplantation.

MATERIALS AND METHODS
Animals
Female golden hamsters weighing 150g-180g were the donors of liver x enografts, and male Wistar rats weighing 230g-260g were the recipien ts. The animals were purchased from Xi Bi Experimental Animal Centre and Shangha i Experimental Animal Centre of Chinese Academy of Sciences.

Liver transplantation
Orthotopic liver transplantation was performed according to simplified three-cu ff technoque^［2］with some modifications. Donor cholecystectomy was perfo rmed at the time of cuff preparation, without reconstruction of hepatic artery, a nd splenectomy at the time of transplantation with simple ligation of the spleni c hilum and excision. No microscope was used for all the operations.

Experimental groups
Liver xenografts were studied in four groups: A,untreated controls (n=8); B, treated with cyclosporine 30mg/kg/daily(n=6); C,treated with s plenectomy (n=6); D,treated with splenectomy and cyclosporine 30mg·kg ·day(n=7).

Immunosuppressants
CsA was administered to recipients intramuscularly beginning on the first day of operation, at an interval of 12 hours. Splenectomy was done at the time of transplantation.

Histology
Postoperative specimens at rejection and specimens taken at sacrifice were fixed in 10% formalin and stained with hematoxylin and eosin.

RNA extraction
Total RNA was extracted according to the Qiagen kit directory. In brief, after h omogenization and lysis with lytic buffer RLT in QIA shredder, same volume of 70% ethanol were added. Samples were then moved into RNeasy spin column and centrifuged for 15sec at 8000×g, buffer RW1 and buffer PRE were added and centrif uged for 15sec at 8000×g step by step. Finally, RNA was eluted with diethyl pyrocarbonate (DEPC)treated water and centrifuged for 1min at 8000×g. The approximate quantity of RNA was determined with an OD 260nm and the purit y was confirmed with an OD ratio of 260∶280 to be greater than 1.8 in all spec imens. RNA was extracted from rat spenocytes stimulated in culture for 18 hours with PHA (10mg/L), Con A (10mg/L) and IL-2 (20 units/mL) for the posi tive control. The RNA of normal rat liver served as negative control.

Reverse transcription and polymerase chain reaction
The cDNA synthesis was performed with GIBCOL BRL kit. RNA mixtures were prepared as follows: 2μg of total RNA and 0.5μg of oligo (dT) 12-18, were added with DEPC-treated water and diluted to 12μL, wa ter bathed at 70℃ for 10min and incubated on ice for at least 1min, then added with 2μL of 10×PCR buffer, 2μL of 25mM MgCl₂, 1 μ L of 10mM dNTP, and 2μL of 0.1M DTT and incubated at 42℃ for 5min. 200U Super Script Ⅱ RT was added and incubated at 42℃ for 50min and the reaction was terminated at 70℃ for 15min and chilled on ice, and finally 1μL of Rnase H was added to each tube and incubated for 20min at 37℃. The cDNA was stored at -20℃.
      The DNA was amplified using RT-PCR on a Perkin-Elmer 2400 thermocycler, and RT -PCR primer was designed according to the exon of rat gene sequences. The pri mer set for perforin was ① 5′GCCATCCTGCGTCTGGACCTG3′, ② 5′CATTTGCGGTGCACG ATGGAG3′; primer set for the granzyme was ① GACTTTGTGCTGACTGCTGCTCAC3′, ② 5′ TTGTCCATAGGAGACGATGCCCGC3′; and for the β-actin: ① 5′TGCTAC ACTGCCACT CGGTCA3′, ② 5′GCATGCTCTGTGGAGCTGTTA3′^［3］. The reaction mixture conta ined 2μL cDNA, 1μL of 10mmol/L dNTP, 3μL of 25mmol/L MgCl₂, 5μ L of 10×buffer, 1μL Taq polymerase, 2μL each of the forward and reverse primer, and 34μL of dual distilled water for each 50μl amplification reaction. R eactions were performed for 30 cycles. The conditions were 94℃ for 3min prior to cycling, denaturing at 95℃ for 15sec, annealing at 60℃ for 20sec and extension at 70℃ for 30sec. Following amplification, ten μL PCR products were run on a 1.5% agarose gel stained with ethidium bromide, gene specific bands were visualized by phot ography under UV fluorescence.

RESULTS
Survival time
Graft survival is shown in Table 1. Groups A, B and C showed rejection in 6-9 d ays. Groups B and C had rejection with a time course similar to group A (P ＞ 0.05). Survival in group D was significantly prolonged to 37.1±9.9 days (P＜0.01).

Table 1 Survival of hamster to rat liver transplantation

^aP＜0.01 as compared with groups A, B and C.

Histological examination
The liver xenografts in group A showed diffuse mononuclear cell infiltration, massive necrosis and interstitial hemorrhage (Figure 1A). In group B, CsA at dose of 30mg·kg·day obviously decreased cellular infiltration, but severe hep atocyte necrosis and hemorrhage remained unchanged (Figure 1B). Splenectomy (group C) significantly alleviated hepatocyte necrosis and hemorrhage, but did not change diffuse mononuclear cell infiltration (Figure 1C). In group D, CsA and splenectomy abated cellular infiltration and hepatocyte necrosis and hemorrhage, the architecture of the hepatic lobule was preserved, but there was slight cellular infiltration in the portal tracts (Figure 1D).

Figure1 Histology of liver grafts.
(A) Diffuse mono nuclear cell infiltration, massive necrosis and interstitial hemorrhage;
(B) Cel lular infiltration obviously decreased, but severe hepatocyte necrosis and hemor rhage unchanged;
(C) Splenectomy significantly alleviated hepatocyte necrosis an d hemorrhage, but didnot change diffus mononuclear cell infiltration;
(D) The ar chitecture of the hepatic lobule was preserved, but there was slight cellular in filtration in the portal tracts.

Expression of perforin and granzyme B genes mRNA
All recipients had the expression of perforin and granzyme B genes mRNA in group A on post-transplantation day (POD) 5; only one (1/6) in group B expressed m RNA of these genes on POD 5; and five recipients (5/6) in group C expressed mR NA of both genes on POD 5. There was no expression of both genes in group D on P OD 5 and 14, but only one recipient (1/7) expressed mRNA of perforin and granz yme B genes on POD 21 (Figure 2).

Figure2 Expression of perforin and granzyme B genes in liver xenografts on POD 7.
A. Perforin;
B. Granzyme B.

DISCUSSION
Gold hamster to rat orthotopic liver transplantation is concordant and heterotra nsplantation and presents with acute rejection. The recipient′s survival can no t prolong until both cellular and humoral rejection are depressed due to its dua l-immune mechanism. Splenectomy can effectively inhibit antibody formation, obviously abated hepatocyte necrosis and hemorrhage, but is unable to improve the diffuse mononuclear cellular infiltration in the grafted liver. CsA can significantly decrease cellular infiltration, but can not improve hepatocyte necrosis and hemorrhage, neither of them can prolong the recipient′s survival when used alone , but they can inhibit both cellular and humoral rejection, normalize the architecture of the grafted liver, and significantly prolong the recipient′s survival to 37.1 days when used in combination. The result is better than that reported abroad^［4］.
      CTL is believed to play an important role in the mechanism of rejection, and effect mechanism of perforin and granzyme B, in spite of the regulatory and effect mechanism underlying the rejection process, remains incompletely understood. Effect of immunosuppression on the expression of perforin and granzyme B mRNA has become a hot topic in recent years. Mueller et al^［5］ analyzed the expression of perforin and granzyme A genes in situ hybridization in cellular infiltrates of MHC mismatched mouse heart transplants both in immunosuppressed recipients treated with CsA and untreated recipients. In untreated grafts, there were many perforin and granzyme A-expressing cells and heart transplants were comp letely rejected on POD 10. In contrast, CsA treatment significantly decreased th e positive cells and prolonged survival of the transplants to 30 days. CsA did not obviously decrease infiltration of CD8+ cells but significantly reduced the number of perforin and granzyme A-positive cells. It shows that CsA treatment mainly depressed the activation of CTL rather than decreased the number of infil trating cells. Rapamycin can completely block the expression of granzyme B gene in infiltrating cells of grafts, obviously prolong the survival of grafts^{［6 ］}.
      Our experimental results show that combined CsA and splenectomy could effectively depress rejection in hamster to rat orthotopic liver transplantation. The architecture of the hepatic lobule was undamaged, and the survival was significantly prolonged, and there were no expression of perforin and granzyme B genes mRNA.
      In conclusion, expression of the CTL-associated gene perforin and granzyme B pr ovides two valuable markers to judge the effect of immunosuppression in acute re jection of liver transplantation. But this should be further confirmed clinicall y.

REFERENCES
1    Griffiths GM,Mueller C.Expression of perforin and granzymes in vivo:potential diagnostic markers for activated cytotoxic
      cells.Immunol Today, 1991;12:415-419
2    Zhang SG, Tan JW, Yang JM. Three cuff in hamster to rat orthotopic liver transplantation.J Sec Milit Med 
      Univ,1998;19:89-90
3    McDiarmid SV, Farmer DG, Kuniyoshi JS. Perforin and granzyme B. Transplant, 1995;59:762-766
4    Valdivia L, Monden M, Gotoh M. Prolonged survival of hamster-to-rat liver xenografts using splenectomy and 
      cyclosporine administration. Transplant, 1987;44:759-763
5    Mueller C, Shao Y, Altermatt HJ. The effect of cyclosporine treatment on the expression of genes encoding granzyme A 
      and perforin in the infiltrate of mouse heart transplants.Transplant,1993;55:139-145
6    Wieder KJ, Hancock WW, Schmidbauer G. Rapamycin treatment depresses intragraft expression of RC/MMP 2, granzyme 
      B and IFN gamma in rat recipients of cardiac allografts.J Immunol,1993;151:1158-166 

Reviews	Add
more>>