Clinical significance of PCR in Helicobacter pylori DNA detection in human gastric disorders

Guo Ming Xu, Xu Huai Ji, Zhao Shen Li, Xiao Hua  Man, Hong Fu Zhang

Subject headings  peptic ulcer;gastritis;stomach neoplasms; Helicobacter pylori;Helicobacter infections;polymerase chain reaction (PCR)

Xu GM, Ji XH, Li ZS, Man XH,  Zhang HF. Clinical significance of PCR in Helicobacter pylori DNA detection in human gastric disorders. China Nati J New Gastroenterol, 1997;3(2):98-100

Abstract

AIM  To investigate the clinical significance of the PCR assay in the diagnosis of gastric H. pylori infection.

METHODS  Hp infection in gastric antral biopsied specimens was identified by the polymerase chain reaction (PCR) to amplify the specific Hp urease gene fragments (PCR-Hp-DNA) in 154 patients with gastrointestinal disorders. Hp urease genes oligonucleotide primers specific for Hp (16s rRNA) were used. Urease test and ELISA for serum anti Hp-IgG were also used as control.

RESULTS  PCR-Hp-DNA was detected in 140(91%) of the 154 patients, 114 and 125 were found infected with Hp by urease test and ELISA Hp IgG, respectively. There was a marked difference in the Hp positive

rate between the PCR-Hp-DNA and the urease test or ELISA-Hp-IgG (P£¼0.05). The rate of Hp infection increased with age although a minority of  infected people develop signs and symptoms of gastric disorders. Hp infection is closely related to adenocarcinoma in gastric antrum and the downbody of the stomach.

CLNCLUSION  PCR is a sensitive and specific method for the detection of Hp in human gastric tissues. Detection of Hp DNA in vivo by this approach might improve the clinical diagnosis and epidemiological research of H. pylori infection.



INTRODUCTION
Helicobacter pylori is now recognized as the major etiologic a_gent of chronic active gastritis, peptic ulceration and a risk factor for the development of adenocarcinoma of the distal stomach^£Û1£Ý. Currently, the phenotypic characteristics known to differ among strains include the production of VacA and the presence of CagA^£Û2£Ý. Mucosal and systemic immunologic recognition of H.pylori infected individual is associated with peptic ulcer disease. However, expression of H. pylori virulence factors in vitro may not accurately reflect the expression occurring in host tissues. In vivo detection of H. pylori gene may improve the sensitivity of clinical diagnosis^£Û3£Ý.
      We used PCR with primers specific for Hp 16s rRNA to detect H. pylori in fection and compared it with rapid urease test and ELISA for serum Hp IgG,and evaluated the sensitivity and specificity of PCR for the detection of H. pylori infection in clinical practice.

PATIENTS AND METHODS

Clinical specimens
A total of 154 patients undergoing gastric endoscopy from the Department of Gastroenterology of the Shanghai Changhai Hospital were studied retrospectively. Patients were excluded if they had a history of gastric surgery, receiving steroids or other immunomodulating drugs, abusing alcohol or illicit drugs, or were HBsAg positive. Among the 154 patients (95 male and 59 female; mean age 51 years, range between 18¡«63 years) with gastric disorders, 40 had chronic superficial gastritis (CSG), 12 chronic atrophic gastritis (CAG), 44 duodenal ulcer, 16 gastric ulcer and 42 gastric carcinoma as established on histological examination.
    Gastric biopsy specimens from gastric antrum (15¦Ìg) were placed immediately in normal saline at 4¡æ and were coarsely homogenized in 400¦Ìl TE buffer (10mM Tris -HCl, 0.1mM EDTA, pH 7.8) with a tissue grinder, 50¦Ìl of homogenized mucus was mixed with 50¦Ìl of lytic solution and added with proteinase K to reach a final concentration of 200?mg/L in Eppendorf. The mixture was incubated  at 50¡æ for 30 min until the tissue pellets were digested completely, and boiled for 10?min. The samples were then centrifuged at 20?000¡Ág for 1 min at 4¡æ, and the supernatants were stored in sterile vials at -75¡æ until they were used as PCR templates.
       Peripheral blood samples were obtained to measure the immunoglobulin G(IgG) response to H. pylori with enzyme linked immunosorbent assay.

PCR amplification
    PCR primers were designed on the basis of the published se_quences of H. pylori 16s rRNA. The primers used were as follows:
    Primer 1: 5¡äGCGCAATCAGCGTCAGGTAATGª²3¡ä
    Primer 2:5¡äª²GCTAAAGAGATCAGCCTATGTCCª²3¡ä
    These primers were synthesized by the automated phosphoramidite coupling method. Amplification of H. Pylori genomic DNA sequences was carried out in 25¦Ìl PCR buffer50mM KCl,10mmol/L Tri HCl (pH 8.3)¡³, 1.5mmol/L MgCl₂, 200¦Ìmol/L deoxynucleotides, 1¦Ìl of boiled H. pylori supernatant as DNA template and the control. The 16s rRNA primers were each used at a final concentration of 0.5¦Ìmol/L. Each reaction was amplified for 36 cycles as follows: 1min at 94¡æ for denaturation, 45 sec at 60¡æ for annealing and 90 sec at 72¡æ for extension. PCR of cDNA from gastric biopsied specimens was performed exactly as described above. Agarose gel electrophoresis with ethidium bromide staining was performed from each PCR mixture. Negative and positive comparisons were made in each experiment.

Enzyme linked immunosorbent assay
The purified H. pylori crude preparation of urease (CPU) antigen was diluted in 0.1mol/L carbonate buffer of pH 9.6 to a final concentration of 0.5mg/L. Polystyrene microtest plates were coated with 100¦Ìl/well of antigen solution and incubated overnight at 4¡æ. 100¦Ìl of each serum sample was added to wells and incubated at 37¡æ for 2h after the plates were washed. After three washings 100¦Ìl/well of a substrate solution was added to each well. Each plate contained a positive and a negative control serum.

Rapid urease test
A 2-mm pinch biopsy was taken from the prepyloric mucosa (within 5?cm of the pylorus, at an angle of about ten o¡äclock), and the tissue was pushed beneath the surface of the reactive solution. In positive cases a red tinge developed around the biopsy at one minute. There was no color changes if H. pylori was absent.

RESULTS
There was marked difference in the positive rates between various methods in the determination of H. pylori infection (Table 1).
H. pylori was detected in 114(74%) of 154 patients using rapid urease test and all of these had a positive PCR results in gastric mucosa.
    Thirty of 40 rapid urease test negative cases were PCR positive. In 125(81%) ELISA positive cases 123 were PCR positive, and 2 were negative (a CSG and a CAG respectively). However, 16 of 29 ELISA negative cases had positive reaction with PCR. Among the 154 patients with antral gastritis, peptic ulcer or gastric carcinoma, H. pylori was found in 140(91%), 114(74%) and 125(81%) by Hp PCR, rapid urease test and ELISA-Hp IgG, respectively, the difference being significant (P£¼0.05). There was a positive correlation among the three methods. The Hp-PCR was the most sensitive and specific. There was no difference between the male (89, 93%) and the female (51, 87%) in Hp-PCR positive results. The age distribution of gastric mucosal H. pylori detected with PCR is shown  in Table 2. The positive rates in various age groups with gastric disorders by PCR method are higher than those by other methods. The H. pylori infections occur earlier and more frequently at all ages in the Chinese than in the Western population.
Table 1  Comparison of urease test, ELISA and PCR for detection of H. pylori in gastric mucosa

Table 2  The age distribution of gastric mucosal H. pylori infection with PCR

Table 3 Stratified analysis of H. pylori infection with respect to tumor location

Table 4  Stratified analysis of H. pylori infection with respect to tumor histological type

      The studies of Hp infection in patients with gastric carcinoma indicated that there was a relationship between Hp infection and the  location of tumor. H. pylori infection was found in 35 of 42(83%) patients with GC using  PCR. GC patients were more likely to be infected by H. pylori than the normal control. In a stratified analysis in tumor location within the upper gastrointestinal tract, H. pylori  infection in noncardia tumors was significantly increased (29/32, 91%). Twenty eight of 30 H. pylori positive GC cases (93%) had intestinal adenocarcinoma.

DISCUSSION
Helicobactor pylori infection has been implicated in the pathogenesis of active chronic gastritis and peptic ulcer. Recently, it has also been identified as a risk factor for gastric cancer. The diagnosis of H. pylori infection is usually based on invasive methods such as biopsy with histological examination, culture and urease test of the gastric biopsy specimens and the noninvasive method such as the ¹³Curea and ¹⁴C urea breath tests. Because of the fastidious growth of H. pylori and the prolonged incubation period required, several alternative approaches have been developed for the accurate and rapid detection of H. pylori in gastric mucosa^£Û4-6£Ý. The urease test ap_peared to have a low sensitivity in detecting H. pylori when compared with the other diagnostic techniques^£Û5£Ý, its sensitivity and specificity ranged from 60%¡«93% and 96% respectively, but with false positive and false negative results^£Û6£Ý. The sensitivity and specificity of the ELISA are 81%ª²97% and 78% 97% respectively^£Û7£Ý.
    Current diagnostic tests for H. pylori infection, however, still involve invasive gastric endoscopy and detection of the organism in gastric biopsy specimens^£Û1,5£Ý. Molecular biological techniques have been applied to the diagnosis of H. pylori infection and both a genomic H. pylori DNA probe and an oligonucleotide probe developed for an H. pylori specific 16s rRNA sequence have been found to detect as few as 10⁴ H. pylori cells. These nucleic an d hybridization methods, however, require the use of ³²Pradioactivity and take up 3 days to provide autoradiographic results. The PCR can selectively amplify the copy number of a target gene more than 10⁶fold. PCR, therefore, has great potential to improve the ability to diagnose infectious diseases caused by fastidious or slow growing microorganisms.
    A rapid, sensitive and specific test for H. pylori would be of great value because of the clinical importance of this pathogen and the large number of laboratory identifications being routinely undertaken around the world. The reference ¡°gold standard¡± used for the comparative detection of H. pylori in clinical biopsy samples was bacteriological culturing^£Û3£Ý. PCR detected H. pylori  in all biopsy samples was found to contain culturable H. pylori. That some samples being negative by rapid urease test and ELISA for Hp-IgG were  found positive by PCR may reflect the high sensitivity of this mothod. PCR, however, detected H. pylori in two of the patients found not to have H. pylori by ELISA for Hp-IgG. The results may represent false positive PCR results or the time difference between the eradication of H. pylori in gastric mucosa and the disappearing of antibodies against H. pylori in serum. PCR analysis of clinical biopsy samples by the boiling DNA extraction method is convenient and sensitive for routine use. Currently, the phenotypic cha_racteristics among strains include the production of a vacuolating cytotoxin (VacA) and the presence of a highª²molecular weight protein encoded by CagA gene (CagA)^£Û8,9£Ý. Although present in most cytotoxic strains, CagA is not necessary for the VacA expression. Expression of these virulence factors in vitro may not accurately reflect the expression occurring in host tissues. So in vivo detection of H. pylori CagA or VacA gene and its expression may improve the diagnosis of toxic H. pylori strains infection^£Û2£Ý. PCR of genomic DNA for H. pylori  CagA gene in the corresponding bacterial isolates was correlated absolutely with CagA or VacA gene expression in gastric tissue. In the near future, the PCR for CagA or VacA gene in gastric mucosa would be very useful in the routine diagnosis and the molecular epidemio_logy reseach of H. pylori.
       The Another main finding in this study was the significantly increased prevalence of H. pylori infection among patients with noncardia gastric cancer compared with the other patients. This difference could not be explained by dietary or socioeconomic factors. Our findings were in agreement with previous results of studies on association between H. pylori infection and gastric cancer^£Û10£Ý. In patients with carcinoma located at the gastric cardia, we found  no significant association with H. pylori infection based on the previous epidemiological and clinical studies. It has been hypothesized that the pathogen esis of the intestinal type of gastric carcinoma may be linked with environmental factors. As chronic atrophic gastritis (type B) has mainly been linked to the intestinal type of gastric carcinoma, H. pylori infection would be expected to show the same relationship. In this study H. pylori infection was found associated with an increased risk of the gastric intestinal adenocarcinoma, and it seems to be an independent risk factor for gastric carcinoma. There are several possible mechanisms by which H. pylori infection may be involved in gastric carcinogenesis. H. pylori adversely affects the chemical and physical properties of the mucous layer, which may make the mucosa susceptible to carcinogenic factors. Moreover, H. pylori seems to promote the progression from normal to metaplastic epithelium, possibly by inducing a hyperproliferative state in the inflamed gastric mucosa. There has been more evidence that H. pylori is a major risk factor for human gastric adenocarcinomas and all low grade B-cell gastric lymphomas. The IARC (International Agency for Research on Cancer) categorized  H. pylori as a carcinogen^£Û11£Ý.
      In conclusion, PCR is a highly sensitive and specific method for the detection of the presence of H. pylori in human gastric tissues. Detection of H. pylori DNA in vivo by this approach may improve the clinical diagnosis and molecular epidemiological research of H. pylori infection.

REFERENCES
1  Tompkins LS, Falkow S. The new path to preventing ulcer. Science, 1995;267(2):1621-1622
2  Telford JL, Ghiara P, Dell'Orco M, Comanducci M, Burroni D, Bugnoli M, et al. Gene structure of the Helicobacter pylori
    cytotoxin and evidence of its key role in gastric disease. J Exp Med, 1994;179(5):1653-1658
3  Peek RM, Miller GG, Tham KT, Perez-Perez GI, Cover TL, Atherton JC, et al. Detection of Helicobacter pylori gene expression
    in human gastric mucosa. J Clin Microbiol, 1995;33(1):28-32
4  Xiang Z, Bugnoli M, Ponzetto A, Morgando A, Figura N, Covacci A, et al. Detection in an enzyme immunoassay of an immune
    response to a recombinant fragment of the 128 kilodalton protein (CagA) of Helicobacter pylori.
    Eur J Clin Microbiol Infect Dis, 1993;12(10):739-745
5  Foxall PA, Hu LT, Mobley HLT. Use of polymerase chain reaction amplified Helicobacter pylori urease structural genes for
    differentiation of isolates. J Clin Microbiol, 1992;30(3):739-741
6  Marshall BJ, Warren JR, Francis GJ, Lanton SR, Goodwin CS, Blincow ED. Rapid urease test in the management of
    campylobacter pyloridis-associated gastritis. Am J Gastroenterol, 1987;82(3):200-210
7  Xiang Z, Censini S, Bayeli PF, Telford JL, Figura N, Rappuoli R, et al. Analysis of expression of CagA and VacA virulence factors
    in 43 strains of Helicobacter pylori reveals that clinical isolates can be divided into two major types and that CagA is not
    necessary for expression of the vacuolating cytotoxin. Infect Immun, 1995;63(1):20-25
8  Marchetti M, Arico B, Burroni D, Figura N, Rappuoli R, Ghiara P. Development of a mouse model of Helicobacter pylori infection
    that mimics human disease. Science, 1995;267(2):1655-1658
9  Crabtree JE, Farmery SM, Lindley IJD, Figura DJ, Peichl P, Tompkins DS. CagA/cytotoxin strains of Helicobacter pylori and
    interleukin-8 in gastric epithelial cell lines. J Clin Pathol, 1994;47(10):945-950
10 Hansson LE, Engstrand L, Nyren O, Evans DJ, Lindgren A, Bergstron R, et al. Helicobacter pylori infection: independent risk
     indicator of gastric adenocarcinoma. Gastroenterology, 1993;105(12):1098-1103
11 Graham DY, Go MF, Genta RM. Helicobacter pylori, duodenal ulcer, gastric cancer: tunnel vision or blinders.
    Ann Med, 1995;27(7):589-594

Department of Gastroenterology, Changhai Hospital, Second Military Medic al University, Shanghai 200433, China.
Prof. XU Guo Ming, male, was born on March 19, 1939 in Wuxi, Jiangsu Province, graduated from Department of Medicine, Shanghai Medical University in 1962, physician in chief, Professor, engaged in the research of gastrointestinal disorders, having over 80 papers and 4 books published.
*This study was partly supported by a grant for the molecular epidemiology of H. pylori infections from the National Natural Science Foundation of China.
Correspondence to  Prof. XU Guo ming
Tel:+86¡¤21¡¤65560684; Fax:+86¡¤21¡¤65560684ª¤
Received  1996-09-11