|
|
|||
|
| |||
|
| |||
|
| |||
|
|
|||
|
He-Bin Fan, An-Shen Chen, Fu-Ming Yan, Xiao-Ju Ma, Hao Zhou, Department of Infectious Disease, The People’s Liberation Army 161 Hospital, Wuhan 430010, Hubei Province, China You-Fu Zhu, Department of Infectious Disease, Nanfang Hospital, Southern Medical University, Guangzhou 510515, Guangdong Province, China Mu-Xiu Zhou, Department of Pathology, The People’s Liberation Army 161 Hospital, Wuhan 430010, Hubei Province, China Author contributions: Fan HB, Zhu YF, Chen AS and Zhou MX performed the majority of experiments; Zhu YF provided vital reagents and analytical tools and was also involved in the collecting of all the human material; Yan FM, Ma XJ, Zhou H edited the manuscript. Supported by National Natural Science Foundation of China, 30271181 Correspondence to: Dr. He-Bin Fan, Department of Infectious Disease, The People’s Liberation Army 161 Hospital, Wuhan 430010, Hubei Province, China. fan_hebin@126.com Telephone: +86-27-50169074 Fax: +86-27-50169007 Received: January 12, 2009 Revised: February 22, 2009 Accepted: March 1, 2009 Published online: April 7, 2009
Abstract AIM: The association of hepatitis C virus (HCV) infection with type II mixed cryoglobulinemia is well established, but the role of HCV in B-cell lymphoma remains controversial. In patients with HCV infection, B-cell clonal expansions have been detected in peripheral blood and bone marrow, and a high prevalence of B-cell non-Hodgkin’s lymphomas has been documented. Liver biopsies in chronic HCV infection frequently show portal lymphoid infiltrates with features of B follicles, whose clonality has not yet been investigated. The object of this study was to determine the frequency of liver-infiltrating monoclonal B-cells in 40 patients with HCV infection.
METHODS: Eight hundred and forty-eight patients were studied prospectively, including 40 HCV-positive patients and 808 patients with chronic hepatitis B virus (HBV) infection. Immunohistochemical study for B- and T-cell markers was performed on the paraffin-embedded liver tissue sections. The clonality of lymphoid B-cells was tested using a polymerase chain reaction (PCR) approach designed to identify immunoglobulin heavy chain gene (IgH) rearrangements.
RESULTS: Liver-infiltrating monoclonal B-cells were detected in the liver for 4 (10%) of 40 HCV-positive patients but were present in only 3 (0.37%) of 808 liver biopsy specimens with chronic HBV infection. Chi-square testing showed that the monoclonal B-cells infiltration in the liver was more frequent in the HCV-infected patients (P = 0.000). A clonal IgH rearrangement was detected in 5 (71.4%) of 7 liver biopsy specimens with monoclonal B-cells infiltration. In 2 of 5 patients with both a clonal B-cell expansion and monoclonal B-cells infiltration in the liver, a definite B-cell malignancy was finally diagnosed.
CONCLUSION: Liver-infiltrating monoclonal B-cells are detected in the liver of patients with chronic HCV and HBV infection. A high percentage of patients with monoclonal B-cells infiltration and B-cell clonality in the liver were finally diagnosed as having a definite B-cell malignancy.
© 2009 The WJG Press and Baishideng. All rights reserved.
Key words: Hepatitis; Hepatitis C virus; B-lymphocytes; Polymerase chain reaction; Gene rearrangement; Clonality
Peer reviewer: Vasiliy I Reshetnyak, MD, PhD, Professor, Scientist Secretary of the Scientific Research Institute of General Reanimatology, 25-2, Petrovka str., 107031, Moscow, Russia
Fan HB, Zhu YF, Chen AS, Zhou MX, Yan FM, Ma XJ, Zhou H. B-cell clonality in the liver of hepatitis C virus-infected patients. World J Gastroenterol 2009; 15(13): 1636-1640 Available from: URL: http://www.wjgnet.com/1007-9327/15/1636.asp DOI: http://dx.doi.org/10.3748/wjg.15.1636
INTRODUCTION The relationship between lymphoproliferative disorders and infectious agents has been recognised and studied for many decades. A causative association between hepatitis C virus (HCV) and non-Hodgkin’s lymphoma (NHL) was postulated relatively recently and has been the subject both of intense investigation and of some debate[1-5]. On the strength of epidemiological data, emerging biological investigations and clinical observations, HCV appears to be involved in the pathogenesis of at least a proportion of patients with NHL[6-7]. This hypothesis is supported by the evidence that HCV is not only hepatotropic, but also a lymphotropic virus[8]. In vitro, HCV is able to replicate in human T-cell lines[9] and in normal peripheral blood mononuclear cells from healthy subjects[10]. Moreover, viral genomic sequences have been found in T- and B-cell populations, as well as in monocyte-derived cells from peripheral blood and liver tissue in patients with HCV-related chronic hepatitis[10-12]. Most studies on HCV-associated B-cell proliferations have focused on peripheral blood and bone marrow lymphocytes. During HCV infection, liver tissue is frequently characterized by prominent lymphoid aggregates in portal tracts that show histological and immunophenotypical features of B follicles[13-14]. The nature of these aggregates has not yet been investigated in detail; in particular, the clonality of B-cells within lymphoid infiltrates in the liver of HCV-infected patients has not been analyzed at the molecular level. In the present study, we analyzed the frequency of liver-infiltrating monoclonal B-cells from the paraffin-embedded liver biopsies of 40 patients with HCV infection. In 7 patients with monoclonal B-cells infiltration in the liver who were followed up, B-cell clonality was tested using a polymerase chain reaction (PCR) approach designed to identify immunoglobulin heavy chain gene (IgH) rearrangements.
MATERIALS AND METHODS Ethics All patients were notified of the risk of the liver puncturation and provided informed written consent.
Selection of cases From June 2003 to December 2005, 848 patients were enrolled in a prospective study and were followed up as outpatients at the Department of Infectious Disease at our NanFang Hospital. In 40 HCV-positive patients (anti-HCV antibody and HCV RNA positive), anti-hepatitis B virus (HBV) and anti-human immunodeficiency virus antibodies were negative. The patients had not received anti-HCV therapy for at least 6 mo. For each patient, a sample of liver biopsy was performed. A control group, consisting of 808 HBV-infected patients with other non-immune chronic liver diseases, was followed up at the same department. All the patients were diagnosed as having chronic hepatitis according to the criteria formulated by the Chinese Society of Infectious disease and Parasitology and Chinese Society of Hepatology, Chinese Medical Association.
Immunohistochemical characterization of lymphoid aggregates The 848 liver biopsies contained 7 monoclonal B-cell infiltrations. The composition of the 7 infiltration cell specimens was investigated by immunohistochemistry, using antibodies against B-cell (L26/CD20) markers, following the streptavidin–biotin-complex immunoperoxidase technique.
Polymerase chain reaction of IgH rearrangements The DNA from the 7 monoclonal B-cells infiltration liver specimens successfully amplified for the b-actin gene was then subjected to clonality assessment by PCR amplification of rearranged IgH genes. After heating for 10 min at 95℃, 2 mL from each sample was added to the PCR mixture containing 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.3), 25 pmol/L of each primer, 200 mmol/L of each dNTP, 1.25 units of Taq polymerase, and 4.5 mmol/L MgCl2 in a final volume of 50 mL. We amplified the hypervariable complementary region (CDR-II and CDR-III), included between the third and joining regions (FR-III and JH) of IgH genes, with a 5'-primer homologous to the FR-III region, and JH as 3'-primers, using a seminested protocol. The primers were FR3, CTGTCGACACGGCCGTGTATTACTG; JH, AACTGCAGAGGAGACGGTGACC. The first PCR cycle consisted of denaturation of the sample DNA at 93℃ for five minutes, annealing of the primers at 55℃ for one minute, then extension of the DNA at 73℃ for two minutes. Each experiment was duplicated and accompanied by a negative control containing no template DNA. Ten microlitres of the PCR products were analyzed by electrophoresis on 3% agarose gels, stained by ethidium bromide, and viewed under UV light.
The histologic features of liver biopsy specimens were analyzed Liver biopsy specimens (> 10 mm in length) were fixed, paraffin-embedded, and stained with hematoxylin-eosin-saffron, and Warthin-Starry stained for collagen. For each liver biopsy specimen, a stage of fibrosis and a grade of activity were established according to the criteria formulated by the Chinese Society of Infectious Disease and Parasitology and Chinese Society of Hepatology, Chinese Medical Association.
Data analysis Categorical variables were compared by chi-square testing, and continuous variables were compared by the two-sided Student t test.
RESULTS Among the 848 patients prospectively included in this study, 40 were HCV-positive (anti-HCV antibody and HCV RNA positive), and 808 were HBV-infected patients. The main characteristics of patients with, and those without, chronic HCV infection are detailed in Table 1. The histological appearance of a B-cell lymphoma is shown in Figure 1. A clonal B-cell expansion was detected in 5 (71.4%) of 7 of the livers with monoclonal B-cells infiltration. In 2 of 5 patients with both a clonal B-cell expansion and monoclonal B-cells infiltration in the liver, a definite B-cell malignancy was finally diagnosed.
DISCUSSION In this study, we addressed the question of whether lymphoid aggregates in the liver of patients with chronic hepatitis C are clonal B-cell proliferations. Seven of the 848 patients have monoclonal B-cells infiltrating in the livers, including 4 of 40 chronic HCV-infected patients and 3 of 808 chronic HBV-infected patients. Five of the 7 patients with monoclonal B-cells infiltration showed a single band, suggesting that they were formed by a single B-cell clone. We were able to observe progression in patients who continued to be followed up after the end of this study. Lymphoma developed in 2 HCV-infected patients out of 5 patients who had monoclonal B-cells infiltration and B-cell proliferation in the liver. Although epidemiological data link HCV infection and NHL, the pathobiological processes leading to clonal B-cell expansion and subsequent malignant transformation are only recently becoming better understood. CD81 has emerged as a potentially key mediator of B-cell/HCV interaction, in light of the finding that CD81 can bind to at least two sites on the HCV envelope protein, E2. CD81/E2 interaction does not apparently promote viral entry into B-cells; however, B-cells with specific anti-HCV surface immunoglobulins can simultaneously interact with viral E2 protein via CD81, resulting in dual activation signals leading to B-cell proliferation. Furthermore, clonal immunoglobulin gene rearrangements from HCV-positive lymphomas often share a similar restricted gene segment usage pattern, as seen in B-cells from patients with mixed cryoglobulinemia, and also show somatic hypermutation, emphasising the link between chronic viral antigenic stimulation and NHL pathogenesis[15-20]. A multistep process has also been documented in a lymphoproliferative disorder in an HCV-infected patient, in whom the bcl-2 translocation was followed by myc translocation during the clinical progression of the disease[21]. However, the wide spectrum of lymphomas that have been described in patients with HCV infection, ranging from lymphoplasmacytoid[2], to MALT-type[22],to follicle-centre cell lymphomas[23], seem to indicate that more heterogeneous and complex processes are probably involved in the lymphomagenesis associated with HCV. In conclusion, in patients with chronic HCV infection, the presence of a B-cell clonality and monoclonal B-cells infiltration in the liver may be useful for detecting patients at high risk for developing malignant lymphoproliferative disease. The importance of B-cell clonality analysis in the course of chronic HCV disease needs to be further evaluated, as do the indications for, and the efficacy of, antiviral treatment in patients at risk for B-cell malignancy.
COMMENTS Background The association of hepatitis C virus (HCV) infection with type II mixed cryoglobulinemia is well established, but the role of HCV in B-cell lymphoma remains controversial. The incidence of B-cell lymphoma is currently rising in line with the progression of hepatitis C though the cause of this increase is largely unknown. Research frontiers Investigating the clonality of B-cells in the liver by analyzing the IgH gene rearrangement has been shown to correlate the development of B-cell lymphoma with HCV-infected patients. Liver biopsies in chronic hepatitis C frequently show portal lymphoid infiltrates with features of B follicles, whose clonality has not yet been investigated. In this study, the authors demonstrate that the clonality of B-cells in the liver may represent a low-grade lymphoma. Innovations and breakthroughs Recent reports have highlighted the importance of antiviral treatment in the HCV-infected patient with B-cell clonality in the liver. This is the first study to analyze the association of monoclonal B-cells infiltration in the liver with the B-cell clonality. Furthermore, our follow up study showed that the lymphoma developed more frequently in the patients who had monoclonal B-cells infiltration and B-cell proliferation in liver. Applications The presence of a B-cell clonality and monoclonal B-cells infiltration in the liver may be useful for detecting patients at high risk for developing malignant lymphoproliferative disease. The study results suggest a strategy for antiviral treatment in patients at risk for B-cell malignancy. Terminology Polymerase chain reaction (PCR) amplification is a method currently in widespread use for detection of clonal IgH rearrangements. In PCR, rearranged DNA is amplified with a series of consensus primers that are complementary to sequences of variable regions; framework 1, framework 2, and framework 3 and to joining regions of the IgH gene. Peer review The authors investigate the association of HCV infection and liver B-cell clonality in a prospective clinical trial. Liver biopsy specimens from 40 HCV-positive patients were analyzed, and specimens from hepatitis B virus (HBV)-positive patients served as a control. This is the first study to describe B-cell clonality in the liver of HCV-infected patients, and the results of their study are of interest.
REFERENCES 1 Franzin F, Efremov DG, Pozzato G, Tulissi P, Batista F, Burrone OR. Clonal B-cell expansions in peripheral blood of HCV- infected patients. Br J Haematol 1995; 90: 548-552 PubMed DOI 2 Silvestri F, Pipan C, Barillari G, Zaja F, Fanin R, Infanti L, Russo D, Falasca E, Botta GA, Baccarani M. Prevalence of hepatitis C virus infection in patients with lymphoproliferative disorders. Blood 1996; 87: 4296-4301 PubMed 3 Paydas S, Kilic B, Yavuz S, Disel U, Tanriverdi K, Sahin B, Burgut R. Anti-HCV and HCV-RNA prevalence and clinical correlations in cases with non-Hodgkin's lymphoma. Am J Hematol 2003; 74: 89-93 PubMed DOI 4 Takeshita M, Sakai H, Okamura S, Oshiro Y, Higaki K, Nakashima O, Uike N, Yamamoto I, Kinjo M, Matsubara F. Splenic large B-cell lymphoma in patients with hepatitis C virus infection. Hum Pathol 2005; 36: 878-885 PubjMed DOI 5 Landau DA, Saadoun D, Calabrese LH, Cacoub P. The pathophysiology of HCV induced B-cell clonal disorders. Autoimmun Rev 2007; 6: 581-587 PubMed DOI 6 Cocco P, Piras G, Monne M, Uras A, Gabbas A, Ennas MG, Palmas A, Murineddu M, Collu S, Melis M, Rais M, Todde P, Cabras MG, Angelucci E, Massarelli G, Nieters A. Risk of malignant lymphoma following viral hepatitis infection. Int J Hematol 2008; 87: 474-483 PubMed DOI 7 Schöllkopf C, Smedby KE, Hjalgrim H, Rostgaard K, Panum I, Vinner L, Chang ET, Glimelius B, Porwit A, Sundström C, Hansen M, Adami HO, Melbye M. Hepatitis C infection and risk of malignant lymphoma. Int J Cancer 2008; 122: 1885- 8 Vallat L, Benhamou Y, Gutierrez M, Ghillani P, Hercher C, Thibault V, Charlotte F, Piette JC, Poynard T, Merle-Béral H, Davi F, Cacoub P. Clonal B cell populations in the blood and liver of patients with chronic hepatitis C virus infection. Arthritis Rheum 2004; 50: 3668-3678 PubMed DOI 9 Shimizu YK, Iwamoto A, Hijikata M, Purcell RH, Yoshikura H. Evidence for in vitro replication of hepatitis C virus genome in a human T-cell line. Proc Natl Acad Sci USA 1992; 89: 5477-5481 PubMed DOI 10 Müller HM, Pfaff E, Goeser T, Kallinowski B, Solbach C, Theilmann L. Peripheral blood leukocytes serve as a possible extrahepatic site for hepatitis C virus replication. J Gen Virol 1993; 74 ( Pt 4): 669-676 PubMed DOI 11 Zignego AL, De Carli M, Monti M, Careccia G, La Villa G, Giannini C, D'Elios MM, Del Prete G, Gentilini P. Hepatitis C virus infection of mononuclear cells from peripheral blood and liver infiltrates in chronically infected patients. J Med Virol 12 Ferri C, Monti M, La Civita L, Longombardo G, Greco F, Pasero G, Gentilini P, Bombardieri S, Zignego AL. Infection of peripheral blood mononuclear cells by hepatitis C virus in mixed cryoglobulinemia. Blood 1993; 82: 3701-3704 PubMed 13 Hino K, Okuda M, Konishi T, Yamashita A, Kayano K, Kubota M, Yasunaga M, Fukumoto Y, Okita K. Analysis of lymphoid follicles in liver of patients with chronic hepatitis C. Liver 1992; 12: 387-391 PubMed 14 Mosnier JF, Degott C, Marcellin P, Hénin D, Erlinger S, Benhamou JP. The intraportal lymphoid nodule and its environment in chronic active hepatitis C: an immunohistochemical study. Hepatology 1993; 17: 366-371 PubMed 15 Carter RH, Fearon DT. CD19: lowering the threshold for antigen receptor stimulation of B lymphocytes. Science 1992; 16 Petracca R, Falugi F, Galli G, Norais N, Rosa D, Campagnoli S, Burgio V, Di Stasio E, Giardina B, Houghton M, Abrignani S, Grandi G. Structure-function analysis of hepatitis C virus envelope-CD81 binding. J Virol 2000; 74: 4824-4830 17 El-Sayed GM, Mohamed WS, Nouh MA, Moneer MM, El-Mahallawy HA. Viral genomes and antigen detection of hepatitis B and C viruses in involved lymph nodes of Egyptian non-Hodgkin's lymphoma patients. Egypt J Immunol 2006; 13: 105- 114 PubMed 18 Rosa D, Saletti G, De Gregorio E, Zorat F, Comar C, D'Oro U, Nuti S, Houghton M, Barnaba V, Pozzato G, Abrignani S. Activation of naïve B lymphocytes via CD81, a pathogenetic mechanism for hepatitis C virus-associated B lymphocyte disorders. Proc Natl Acad Sci USA 2005; 102: 18544-18549 PubMed DOI 19 Ivanovski M, Silvestri F, Pozzato G, Anand S, Mazzaro C, Burrone OR, Efremov DG. Somatic hypermutation, clonal diversity, and preferential expression of the VH 51p1/VL kv325 immunoglobulin gene combination in hepatitis C virus-associated immunocytomas. Blood 1998; 91: 2433-2442 PubMed 20 De Re V, De Vita S, Marzotto A, Rupolo M, Gloghini A, Pivetta B, Gasparotto D, Carbone A, Boiocchi M. Sequence analysis of the immunoglobulin antigen receptor of hepatitis C virus-associated non-Hodgkin lymphomas suggests that the malignant cells are derived from the rheumatoid factor-producing cells that occur mainly in type II cryoglobulinemia. Blood 2000; 96: 3578-3584 PubMed 21 Ellis M, Rathaus M, Amiel A, Manor Y, Klein A, Lishner M. Monoclonal lymphocyte proliferation and bcl-2 rearrangement in essential mixed cryoglobulinaemia. Eur J Clin Invest 1995; 25: 833-837 PubMed DOI 22 Luppi M, Grazia Ferrari M, Bonaccorsi G, Longo G, Narni F, Barozzi P, Marasca R, Mussini C, Torelli G. Hepatitis C virus infection in subsets of neoplastic lymphoproliferations not associated with cryoglobulinemia. Leukemia 1996; 10: 351- 355 PubMed 23 Ferri C, Caracciolo F, Zignego AL, La Civita L, Monti M, Longombardo G, Lombardini F, Greco F, Capochiani E, Mazzoni A. Hepatitis C virus infection in patients with non-Hodgkin's lymphoma. Br J Haematol 1994; 88: 392-394 PubMed DOI S- Editor Li LF L- Editor Logan S E- Editor Zheng XM
| |||
| |||||||
|
|
