Search Article Keyword:  

PubMed Submission Abstract PDF Feed Back Count: 381 Download Count: 174 

ISSN 1007-9327 CN 14-1219/R  World J Gastroenterol  2008 February 7; 14(5): 782-789

RAPID COMMUNICATION

HQuantitative studies of the regular distribution pattern for Salmonella enteritidis in the internal organs of mice after oral challenge by a specific real-time polymerase chain reaction

Shu-Xuan Deng, An-Chun Cheng, Ming-Shu Wang, Ping Cao, Bin Yan, Nian-Chun Yin, Sheng-Yan Cao, Zhen-Hua Zhang


Shu-Xuan Deng, Ping Cao, Bin Yan, Nian-Chun Yin, Sheng-Yan Cao, Zhen-Hua Zhang, Avian Diseases Research Center, College of Veterinary Medicine of Sichuan Agricultural University, Yaan 625014, Sichuan Province, China

An-Chun Cheng, Ming-Shu Wang, Avian Diseases Research Center, College of Veterinary Medicine of Sichuan Agricultural University; Key Laboratory of Animal Diseases and Human Health of Sichuan Province, Yaan 625014, Sichuan Province, China

Ming-Shu Wang, College of Life Science and Technology of Southwest University for Nationalities, Chengdu 610041, Sichuan Province, China

Author contributions: Deng SX, Cheng AC and Wang MS contributed equally to this work; Deng SX, Cheng AC and Wang MS designed research; Deng SX, Cao P, Yan B, Yin NC, Cao SY and Zhang ZH performed research; Deng SX analyzed data and wrote the paper

Supported by The National Key Technology R&D Program of China, No. 2004BA901A03; National Scientific and Technical Support Program, No. 2007Z06-017; The Cultivation Fund of the Key Scientific and Technical Innovation Project & Ministry of Education of China, No. 706050; Program for New Century Excellent Talents in University, No. NCET-04-0906/NCET-06-0818; Sichuan Province Basic Research Program, No. 04JY0290061/07JY029-017 and Program for Key Disciplines Construction of Sichuan Province No. SZD0418

Correspondence to: Professor An-Chun Cheng, Avian Diseases Research Center, College of Veterinary Medicine of Sichuan Agricultural University, Yaan 625014, Sichuan Province, China. chenganchun@vip.163.com

Telephone: +86-835-2885774 Fax: +86-835-2885774

Received: November 27, 2007  Revised: November 30, 2007

  

Abstract

AIM: To identify and understand the regular distribution pattern for Salmonella enteritidis (S. enteritidis) in the internal organs of mice after an oral challenge over a
3 wk period.

 

METHODS: Assays based on the serovar-specific DNA sequence of S. enteritidis from GenBank, and a serovar-specific real-time, fluorescence-based quantitative polymerase chain reaction (FQ-PCR) were developed for the detection of S. enteritidis. We used this assay to detect genomic DNA of S. enteritidis in the blood and the internal organs, including heart, liver, spleen, kidney, pancreas, and gallbladder, from mice after oral challenge at different time points respectively.

 

RESULTS: The results showed that the spleen was positive at 12 h post inoculation (PI), and the blood was at 14 h PI. The organism was detected in the liver and heart at 16 h PI, the pancreas was positive at 20 h PI, and the final organs to show positive results were the kidney and gallbladder at 22 h PI. The copy number of S. enteritidis DNA in each tissue reached a peak at 24-36 h PI, with the liver and spleen containing high concentrations of S. enteritidis, whereas the blood, heart, kidney, pancreas, and gallbladder had low concentrations. S. enteritidis populations began to decrease and were not detectable at 3 d PI, but were still present up to 12 d PI in the gallbladder, 2 wk for the liver, and 3 wk for the spleen without causing apparent symptoms.

 

CONCLUSION: The results provided significant data for understanding the life cycle of S. enteritidis in the internal organs, and showed that the liver and spleen may be the primary sites for setting itself up as a commensa over a long time after oral challenge. Interestingly, it may be the first time reported that the gallbladder is a site of carriage for S. enteritidis over a 12 d period. This study will help to understand the mechanisms of action of S. enteritidis infection in vivo.

 

© 2008 WJG. All rights reserved.

 

Key words: Fluorescence-based quantitative polymerase chain reaction; Internal organs; Salmonella enteritidis; Regular distribution pattern

 

Peer reviewer: Wang-Xue Chen, Dr, Institute for Biological Sciences, National Research Concil Canada, 100 Sussex Drive, Room 3100, Ottawa, Ontario K1A 0R6, Canada

 

Deng SX, Cheng AC, Wang MS, Cao P, Yan B, Yin NC, Cao SY, Zhang ZH. Quantitative studies of the regular distribution pattern for Salmonella Enteritidis in the internal organs of mice after oral challenge by a specific real-time polymerase chain reaction. World J Gastroenterol 2008; 14(5): 782-789  Available from: URL: http://www.wjgnet.com/1007-9327/14/782.asp  DOI: http://dx.doi.org/10.3748/wjg.14.782

  

INTRODUCTION

A significant proportion of human salmonellosis is caused by consumption of raw or partially cooked eggs[1-3]. Salmonella enteritidis (S. enteritidis) is one of the main causes of gastrointestinal infection in China. Incidence of infection is highest in children, elderly, and immuno-suppressed individuals[4]. S. enteritidis is a facultative intracellular pathogen capable of causing disease in a wide range of host species. After oral ingestion, S. enteritidis cells rapidly reach the bowel and penetrate the macrophages, spread to the mesenteric lymph nodes, and in severe cases, can reach the circulatory system[5]. The macrophages carry the organism to the liver, pancreas, and spleen, where the bacteria are thought to replicate in both phagocytic and nonphagocytic cells[5]. Also, it was reported that the S. typhimurium can be shed into the gallbladder from the liver, where either an active infection (cholecystitis) or a chronic infection can develop[6,7].

Previous studies showed that S. enteritidis was usually cleared from internal organs more than 8 wk after inoculation of poultry. How S. enteritidis survives within macrophages is unclear. It seems likely that the type secretion system encoded by Salmonella pathogenicity island 2 may play a major role. Moreover, extensive studies of mouse have shown the role for T cells, natural killer cells, macrophages, neutrophils and numerous cytokines in Salmonella resistance[8,9]. Numerous studies indicate that S. enteritidis cells have evolved strategies to resist and overcome innate immune defenses[10,11]. Up to date, the mechanisms by which S. enteritidis and other serotypes persist within the host and the reasons for the absence of immune clearance are not known. As a result of the increased prevalence of S. enteritidis and its complex life cycle, identifying the regular distribution pattern of S. enteritidis in the internal organs over a 3 wk period, which is not described hitherto, will help to understand its mechanism of action.

One of the main advantages of FQ-PCR is the ability to quantitate unknown samples. With this assay, it is possible to carry out a rapid quantitative analysis of DNA over a wide linear range, with an unknown template. The specific DNA fragment (Sdf I) of S. enteritidis was reported by Agron et al[12], which was screened for using the Supression Subtractive Hybridization method, and appears to only be found in serovar enteritidis strains[12,13]. Here, based on the study of Agron et al, we developed a standard curve (this methodology is the first time established which based upon the Sdf I DNA fragment), and then applied this to the study of internal organ distribution of S. enteritidis in mice.

 

MATERIALS AND METHODS

Bacterial strains

A total of 19 Salmonella strains were included in this study. Most strains were purchased from the National Center for Medical Culture Collection, including S. enteritidis (Human, No. 50041), S. enteritidis (Human, No. 50040), S. enteritidis (Mouse, No. 50338), S. enteritidis (Human No. 50100), S. enteritidis (Human, No.50128), S. enteritidis (Human, No. 50335), S. enteritidis (Mouse, No. 50336), S. enteritidis (Human, No. 50760), S. choleraesuis (No. 50191-1), S. typhi (No. 50013), S. typhimurium (No. 50115-13), S. paratyphi (No. 50001-24), S. pullorum (No. 50047-2), S. anatum (No. 50083-4), S. gallinarum (No. 50770), S. dublin (No. 50761). Three strains were isolated and maintained by the Avian Diseases Research Center, Collage of Veterinary Medicine of Sichuan Agricultural University, including S. enteritidis (Duck, No. MY1), S. enteritidis (Duck, No. SC1), S. enteritidis (Chicken, No. CD1).

 

Preparation of bacterial samples and generation of standard templates

Briefly, 5 mL of bacterial culture was grown overnight in Luria-Bertani broth and 500 mL of the culture was harvested by centrifugation. The pellet was resuspended in 500 mL TE buffer (pH 8.0) and 2 mL of lysozyme solution (30 g/L) was added, followed by lysis using 10% SDS (80 mL) at 60 for 1 h. DNA was purified by extraction with an equal volume of phenol/chloroform/isoamyl alcohol (25:24:1). Then, a 1/10 volume of 3 mol/L sodium acetate and 2 volumes absolute ethanol were added, and the nucleic acid was then pelleted by centrifugation, washed with 70% ethanol, and dried under vacuum. The DNA genomic pellet was resuspended in 30 mL TE buffer (pH 8.0), and stored at -20 until use.

A conventional PCR was carried out using a template from S. enteritidis (Chicken, No. CD1), with primers F1 and R1 (designed with Sdf I, Genbank Accession No. AF370707.1, generated by TakaRa Biotech, DaLian, China). The primer sequences from 5’ to 3’, were as follows: F1, TGTGTTTTATCTGATGCAAGAGG; and R1, CGTTCTTCTGGTACTTACGATGAC. Amplification was carried out in a total volume of 50 mL, containing 1 mL each primer (25 mmol/L), 1 mL dNTPs (10 mmol/L), 2.5 U Taq DNA Polymerase (TaKaRa Taq, TakaRa Biotech), 5 mL 10 × PCR buffer (with Mg2+, 25 mmol/L), and 6 mL templates, then made up to a volume of 50 mL with deionized water. An initial denaturation at 95 for 5 min was followed by 32 cycles of denaturation at 94 for 30 s, annealing at 52.5 for 30 s, and extension at 72 for 40 s. Finally, an additional extension was achieved for 10 min at 72. The product size was 293 bp.

Finally, the product was gel-excised and quantified with appropriate standards. Its concentration was determined spectrophotometrically using the Bio-Rad-Smartspec-3000 instrument, according to the manufacturer’s instructions. The standards were diluted, divided into aliquots, and frozen before used.

 

Development of FQ-PCR and its products

The FQ-PCR assay, including volume, Mg2+ concentration, probe and primer concentrations, and annealing temperature were optimized initially. Subsequently, the sensitivity of the assay, the linear range and standard curve were determined by using known amounts of purified template DNA (generated as described above). The primers (F2 and R2) and TaqMan-probe (FP) of FQ-PCR were designed using an internal region of the 293 bp sequences (described above, generated by TakaRa Biotech), and were used as follows, from 5’ to 3’: F2, TTGATGTGGTTGGTTCGTCACT; R2, TCCCTGAATCTGAGAAAGAAAAACTC; and TaqMan-probe (FP), FAM- TGCAGCGAGCATGTTCTGGAAAGC-TAMRA.

Amplification of FQ-PCR was carried out in a total volume of 25 mL, containing 0.6 mL each primer
(10
mmol/L), 0.75 mL dNTPs (10 mmol/L), 1.25 U EX Taq DNA Polymerase (TaKaRa EX Taq Hot Start Version, TakaRa Biotech), 5 mL 5 × PCR buffer (free Mg2+), 0.8 mL TaqMan-probe (5 mmol/L), 0.5 mL Mg2+ (250 mmol/L) and 5 mL aliquot of the sample DNA templates (for the standards DNA templates, 1 mL was added), then made up to a volume of 25 m
L with deionized water. Each run consisted of a 95 5 min hot start, which activated the conjugated polymerase, followed by 45 cycles with a 94 denaturation for 30 s, 55 annealing for 30 s, and reading the fluorescent signal at this step.

The primers of FQ-PCR (F2 and R2) were used for conventional PCR with S. enteritidis (Chicken, No. CD1) DNA templates, in order to verify the specific amplification. Amplification was carried out in volume of 50 mL, containing 1 mL each primer (25 mmol/L), 1 mL dNTPs (10 mmol/L), 2.5 U Taq DNA polymerase (TaKaRa Taq, TakaRa Biotech), 5 mL 10 × PCR buffer (with Mg2+, 25 mmol/L), and 6 mL templates, then made up to a volume of 50 mL with deionized water. An initial denaturation at 95 for 5 min was followed by 32 cycles of denaturation at 94 for 30 s, annealing at 49 for 30 s, and extension at 72 for 40 s. Finally, an additional extension was achieved for 10 min at 72. A 10 mL aliquot of PCR product was electrophoresed on a 1.5% agarose gel for 40-50 min at 80 V, and visualized and photographed under UV illumination. Simultaneously, DNA sequences of the products were carried out by TakaRa Biotech.

 

FQ-PCR standard curve

Based on the previous studies to generate the standard curve as follows[14-16]: Standards DNA were used to establish a standard curve and the standards contained amplified target DNA in different quantities which were measured by fluorimetic analysis (iCyclerQ, Bio-Rad, USA). The Primers F2 and R2 were used for this amplification, the DNA was 10-fold serially diluted in nuclease-free water and standard curve was generated by using 1.0 × 105 to 1.0 × 1010 gene copies of standards DNA. Concentrations of the standards were measured by fluorimetic analysis, then an analysis of key cycler measurements were performed after each run to verify identical amplification efficiencies and conditions between runs. Finally, based on the data generated, a standard curve for the icycler was obtained and based on the standard curve to obtain the copies number of S. enteritidis for the samples.

 

Specificity,Sensitivity and Reproducibility of the FQ-PCR

All 19 bacterial strains were used to assess the specificity of the FQ-PCR. The phenol/chloroform/isoamyl alcohol method (described above) was used to prepare the DNA template, 6 mL of this aliquot was used in FQ-PCR.

To determine the detection limit of this FQ-PCR assay, different quantities of standard DNA of S. enteritidis was added. We used phenol/chloroform/isoamyl alcohol method to extract DNA of tissue from several control group samples (described below), and added 1.0 × 105-1.0 × 10-1 copies of the standard DNA for each. Finally the results were measured by fluorimetric analysis.

To evaluate the variability between experiments, three different known concentrations of DNA were amplified by performing the assay described above in triplicate. For each experiment, the crossing point, average crossing point, standard deviation, and coefficient of variation for each assay were calculated.

 

Experimental infection of mice

Our infection model was based on the previous studies, which showed that orally introduced S. enteritidis had a rapid transit time through the intestine and established itself within the walls of the gut in more than 3 d[17,18]. 80 mice (age 9 wk, specific-pathogen-free) were purchased from the Animal Center of Sichuan University, China. In brief, a group of 60 mice was oral infected with a virulent S. enteritidis strain (Chicken, No. CD1, LD50 is 4.0 × 108 cells after oral challenge), at 4.0 × 106 cells per mouse (In our preliminary experiments, the results showed that this dose of challenge can induce clinical signs and pathology in mice, but can not cause death). Another group of 20 mice was treated with an equal volume of water as a control. Blood, heart, liver, spleen, kidney, pancreas, and gallbladder were analyzed by FQ-PCR at different post-inoculation time points, at 30 min, 1 h, 2 h, 4 h, 8 h, 12 h, 14 h, 16 h, 18 h, 20 h, 22 h, 24 h and 36 h and 2 d, 3 d, 6 d,9 d,12 d and 2 wk,3 wk.

Three mice from infected group and one from control group were sacrificed at each time point (There was a potential complication of S. enteritidis DNA in the blood for the tissue results, particularly in the spleen and liver where large amounts of blood could be accumulated, so the mice were perfused before the tissue collection) and its organs were aseptically harvested and immediately placed in 1.5 mL labeled snap-cap tubes, and frozen. The blood sample, 200 mL, was obtained from the vena caudalis with syringe aseptically before sacrificed. For the bile sample, 200 mL was obtained from gallbladder with syringe aseptically after sacrificed, and frozen.

DNA extraction from tissue samples was described below: Briefly, 0.5 g of the tissue sample was ground up using a tissue grinder in the 1.5 mL Eppendorf tube. The pellet was resuspended in 500 mL TE buffer (pH 8.0) with 10 mL Proteinase K (30 g/L) and incubated at 37 for 2 h. Finally, with a conventional phenol/chloroform/isoamyl alcohol method (described above), to extract the genomic DNA of S. enteritidis from tissue, used 5 mL aliquot of DNA template for FQ-PCR detection.

For the bile and blood samples, taking 200 mL to be harvested by centrifugation, then the pellet was resuspended in 500 mL TE buffer (pH 8.0) with 3 mL Proteinase K (30 g/L), and incubated at 37 for 1 h. Finally, used the phenol/chloroform/isoamyl alcohol method (described above) to extract DNA template and used 5 mL to be detected.

 

Comparative the differences between FQ-PCR and the traditional bacterial culture method

All the samples of mice were detected by the traditional bacterial culture method in order to identify the accuracy of this FQ-PCR method. Firstly, taking 0.1 g or 20 mL tissue sample, then used the selective enrichment media-Selenite Cystine Broth, incubated at 37 for 20 h. And then, transferred to Salmonella Shigella Agar (SS agar). two differential media, Macconkey agar and Triple sugar iron agar were streaked and incubated at 37 for 24 h. Suspected colonies were picked up for biochemical and serological tests. The following tests were used glucose, maltose, arabopyranose, mannitol, glycitoi, Hydrogensulfide, MR, lysinedecarboxylase, argininedecarboxylase, orinithinedecarboxylase, et al.

Serotypes were identified by multivalence serum of OA-F and O1,9,12 factor serum. The results were referred to[19,20] incomplete sentence-authors must complete.

 

Statistical analysis

All samples were analyzed three times with a mean and standard error. Data were analyzed on an IBM compatible personal computer using SPSS version 11.0. Effects were considered to be significant if P < 0.05. Finally, based on the standard curve (described aboved) to obtain the copies number of S. enteritidis. The S. enteritidis DNA copy concentrations were expressed as the mean log10 copies genome numbers per 0.5 g or 0.2 mL of tested tissue or blood and bile, respectively.

 

RESULTS

Specific verification of FQ-PCR products

The primers of FQ-PCR were used for conventional PCR with S. enteritidis (Chicken, No. CD1) DNA templates, in order to verify the specific amplification. Results showed that the PCR produced an intense band with the expected 130 bp for S. enteritidis, which indicated 100% specificity. Also, Sequence analysis was carried out using BLASTn and BLASTn Programs of National Center for Biotechnology Information, and resulted in 100% homology with DNA of S. enteritidis, Genbank Accession No.AF370707.1.

 

FQ-PCR standard curve

By using standards template containing from 1.0 × 105 to 1.0 × 1010 copies, accurate results for a series of samples were obtained, based on the data used to generate the standard curve with the iCycler IQ Detection System (Bio-Rad; USA). The correlation coefficient for the associated standard curve was 1.000 and PCR efficiency was 98.2%, which indicated that the crossing threshold values for the standards fell within accurate range. Through the formula as follows, we could quantitate the DNA copies of S. enteritidis for unknown samples, Y= -3.366X + 44.914 (where Y is the threshold cycle, and X is the log of the starting quantity) (Figure 1).

 

Specificity, sensitivity and reproducibility of the FQ-PCR

All 19 bacterial strains were used to assess the specificity of the FQ-PCR, indicated that only S. enteritidis strains genomic showed the positive results, while there was no positive results with none S. enteritidis strains.

A range from 1.0 × 105 to 1.0 × 10-1 copies of S. enteritidis standards template was used, the limit of detection was 10 copies/mL.

Three different, known concentrations of DNA, 1.0 × 109 to 1.0 × 107 copies/mL, were amplified by performing the assay described above in triplicate. Analysis of these values proved that the assay was reproducible, as the coefficient of variation was statistically low, at < 1.8%, the standard deviation was 1.1%, and the threshold cycle for each concentration was difference between 0.2 cycle and 0.4 cycle, highly reproducible.

 

Clinical signs and gross necropsy

S. enteritidis-inoculated mice appeared to be clinically normal, and there were no sings of depression or diarrhea, and feeding and drinking behavior remained normal at 30 min to 8 h, and 6 d to 3 wk PI. However, mice developed significant clinical signs of S. enteritidis infection at 12 h to 3 d PI. At necropsy, gross lesions were observed in all of the mice at this period, such as hyperemia of intestine, swelling of gallbladder [19,20].

 

Distribution of S. enteritidis in the internal organs

The distribution of S. enteritidis within the internal organs after oral challenge was determined by means of FQ-PCR, over a 3 wk period at intervals. Results showed that the spleen was positive at 12 h PI, with about 2.95 × 102 copies/0.5 g. Then, blood had positive results at 14 h PI with about 2.75 × 102 copies/0.2 mL, and the organism was detected in the liver and heart at 16 h PI, pancreas was positive at 20 h PI, and the last organ to show a positive results were the kidney and gallbladder at 22 h PI. The copy numbers of S. enteritidis in each tissue reached a peak at 24-36 h PI, with the liver, spleen containing high concentrations of S. enteritidis, about 2.00 × 104 to 3.31 × 106 copies/0.5 g, whereas the blood, heart, kidney, pancreas and gallbladder had low concentrations, ranked from 5.13 × 102 to 1.70 × 105 copies/0.5 g (0.2 mL). Numbers of bacteria decreased at 3 d-9 d, the level of S. enteritidis clearly decreased, with the blood, heart, kidney, and pancreas not having a positive result. The mice were capable of carrying S. enteritidis cells were present up to 12 d PI in the gallbladder, 2 wk for the liver, and 3 wk for the spleen without causing any apparent symptoms. Importantly, the level of S. enteritidis cells number compared to the other organs at 2-12 d PI, the gallbladder can contain about 1.25 × 102 to 7.94 × 102 copies/0.2 mL. It may be the first time reported that the gallbladder is a site of carriage for S. enteritidis, and S. enteritidis can persist over a 12 d period within it. Also, the control group did not have any positive results at any time in any location. The details are shown in Table 1.

 

The results of the traditional bacterial culture method

All the samples from different time points were detected by traditional bacterial culture method, and the results showed that the traditional bacterial culture method had positive results when the S. enteritidis target DNA concentrations were > 104.02 copies per 0.5 g or 0.2 mL. Apparently, the FQ-PCR assay provides a more sensitive and accurate method for the this study.

 

DISCUSSION

Once attached to the host cells, S. enteritidis can manifest athletic phenomenon of invasion, such as phagocytized by cell invagination. After fused by macrophage, S. enteritidis cells will appear in cytoplasm, survive and multiply there[21]. Humoral immunity contributes to serve as the first line of defense against S. enteritidis infection. After the S. enteritidis cells are swallowed by macrophage and heterophil granulocyte, both of them happen to outbreak of breathing and produce oxygen free radical, for instance H2 O2-, OH-, O2-[22], which can kill and wound the bacterium. The cell factors, such as IL-1, IL-6 et al, also have the bactericidal effect for the S. enteritidis invasion[23]. In contrast, cellular immune responses have been rarely investigated, although such responses are crucial for protective immunity against S. enteritidis. The mechanisms by which Salmonella-specific CD4+ T cells contribute to protective immunity are incompletely understood, but T-cell proliferation, the sine qua non of CD4+ T-cell activation, and the production of gamma interferon can be regarded as in vitro indicators of these essential elements of protective immunity[24]. Our data (Table 1) showed that the S. enteritidis populations decreased obviously or were not detectable in most detected-samples at 6 d PI, without causing apparent symptoms. Perhaps, the results of this study indicate that the mice have an efficient protective immunity after oral challenge.

Salmonella cells have to attach to or form a close association with the intestinal epithelium in order to establish and persist in the gut and subsequently invade the underlying tissues[25,26]. S. enteritidis usually do not cause a disseminated systemic disease in humans, but clinically manifest as gastroenteritis and diarrhea[27]. The probability of establishment of persistent infection may involve a subtle interplay between host susceptibility and the challenge strain and does of S. enteritidis[10,28]. It has been reported that S. enteritidis can rapid distribution throughout the gastrointestinal tract, translocation to the mesenteric lymph nodes and spread to the liver and spleen of the mice. In the liver, the bacteria are ingested by the Kupffer cells, and then they invade the hepatocytes[29, 30]. In our studies, the spleens were positive at 12 h PI, but not the blood. It may be an indication that S. enteritidis cells were drained by the lymphatic system circulation (especially the Peyer,s patchs in gut) priority. Also, recent studies have shown that some systemic spread of salmonella can occur without drainage through the lymphatic system and blood circulation[31]. Pathogen sampled subepithelially or even luminally by dendritic cells or CD18-expressing phagocytes can be transferred directly to the liver and spleen[32,33].

Previous studies showed that there is a association between Salmonella and intracellular survival in macrophages, which can be regarded as safe sites for bacterial multiplication[34,35]. However, how S. enteritidis survives within macrophages is unclear. It seems likely that the type secretion system encoded by Salmonella pathogenicity island 2 may play a major role[36,37]. One of the functions of Salmonella pathogenicity island 2 is to inhibit NADPH oxidase-dependent killing of Salmonella[38] . Also, it has been reported that the S. typhimurium genome encodes many mechanisms that allow resistance to the stressful environment encountered within the macrophage. Such stress include the production by NADPH oxidase of superoxide anion (O2-) and other reactive oxygen species (ROS), and by inducible nitric oxide (NO) synthase (iNOS) of NO and other reactive nitrogen species (RNS)[39,40]. A number of important bacterial pathogens infect, replicate, and persist within nucleated cells of the host, T-cell-mediated immunity has proven to be a critical factor in the effective clearance of many such intracellular bacterial pathogens. However, Salmonella can induce suppression of cellular responses[41]. Simultaneously, it has been reported that chicken macrophages display differences in their responses to S. enteritidis and S. typhimurium, and contribute to the differential pathogenesis of these Salmonella serovars[42]. Also, it has been reported that S. enteritidis infection induce less inflammation resulting in a more commensal, while S. typhimurium infection can be cleared more rapidly by induction of inflammatory[43,44]. S. enteritidis resulted in increased splenic CD3 and reduced B populations, it was difficult to associate this increase with S. enteritidis clearance due to lack of any significant changes in CD4+ of CD8+ cells[45].The functions of the spleen and liver in filtration, immune responsiveness and activation of complement have been well documented. Spleen is a container for the lymphocyte-rich white pulp and macrophage-rich red pulp; it is comprised of distinctive B cells and macrophages. So, what we described above may be the reason for why significant number of S. enteritidis cells can persist over a long time in liver and spleen without causing apparent symptoms in vivo in this study. Up to day, the colonization mechanism of S. enteritidis in the gut and the internal organs are not clear and further studies should be carried out.

Interestingly, the gallbladder is a site of carriage in this study, it is also the storage site for bile. Our studies may be the first to report that S. enteritidis can persist for as long as 12 d PI in gallbladder in mice. Bile is produced in the liver and consists of many components, including bile salts, cholesterol, and bilirubin. Bile salts are detergents that aid in degradation and dispersion of lipids, and such make bile a good antimicrobial agent[7]. It has been reported that Salmonella is resistant to high concentrations of bile and individual bile salts[46]. From the liver, the S. typhimurium can be shed into the gallbladder, and this infection is frequently associated with gallbladder abnormalities, such as gallstones, also, this infection is often asyptomatic and can last for many years[5,6]. Biofilms have recently been implicated as the cause of many chronic infection in human[47]. S. enteritidis are capable of shielding themselves from environmental stress, host immune response and phagocytosis by the secretion of an apparently amorphous matrix of secreted polysaccharides[47-50]. This matrix provides a very stable environment and results in high levels of resistance to antimicrobial agents[46,50]. Often, it is difficult to clear the infection unless the substrate to which the bacteria are attached is removed[7]. In our studies, S. enteritidis cells can persist for 12 d PI with low concentrations, about 1.25 × 102 to 6.61 × 102 copies/0.2 mL. The gallbladder appeared to be gross lesion (such as swelling) at 20 h to 2 d PI. Interestingly, there were not any significant gross lesions over the 3-12 d PI period, although there was nearly the same number of S. enteritidis cells over the 12 d period.

FQ-PCR has become a potentially powerful alternative in microbiological diagnostics due to its simplicity, rapidity, reproducibility, and accuracy[51,52]. However, variation results may be due to either the PCR inhibitors, or a large amount of DNA from background organism DNA. In preliminary experiments, we used phenol/chloroform/isoamyl alcohol method to extract DNA of tissue from several control group samples (described above), and added 1.0 × 105 copies of the standard DNA for each. Finally, fluorimetic cycler measurements were performed as described above. The results showed that all the tests can obtain the expected data and the variability was statistically low, at < 4.3%. So, this methodology is very accuracy for studying on the distribution of S. enteritidis in the internal organs.

In conclusion, our results provide significant data for helping to clarify the pathogenic mechanism of S. enteritidis in the internal organs, and show that the liver and the spleen are the primary sites of invasion in normal mice after oral challenge, interestingly, the gallbladder is a site of carriage over a 12 d period in this study, to our knowledge, this is the first time reported, and future studies should be carried out.

 

COMMENTS

Background

There are over 2500 serovars in the genus Salmonella. It has been a public health concern for over 100 years, and the incidence of Salmonella infections has risen dramatically, especially those caused by S. enteritidis. Therefore, knowledge about Salmonella infection could be an additional means for decreasing the incidence of infection. Infection with Salmonella is usually started by oral ingestion of the pathogen, and is followed by bacterial colonization of the gut and invasion of internal tissues. As a matter of course, it is necessary to understand its mechanisms of action in the internal organs.

 

Research frontiers

To date, the regular distribution pattern for S. enteritidis in the internal organs of mice after oral challenge has not been established. FQ-PCR, as a rapid, sensitive technique for precise quantitation of nucleic acid, will be an ideal method to study the distribution of S. enteritidis in the internal organs.

 

Innovations and breakthroughs

These studies have identified the regular distribution pattern of S. enteritidis invasion in the internal organs, which is not described hitherto. Moreover, it may be the first time reported that the gallbladder is a site of carriage for S. enteritidis over a 12-d period.

 

Applications

This study will provide significant data for clarifying the pathogenic mechanisms of S. enteritidis in the internal organs, and may ultimately lead to new insights in prevention and therapy.

 

Peer review

The manuscript by Deng and colleagues represents a clear and straight-forward study into the distribution and persistence on S. enteritidis in the internal organs of infected mice. The hypothesis and methods are clearly presented, and the results will help future studies.

 

REFERENCES

1      Hope BK, Baker R, Edel ED, Hogue AT, Schlosser WD, Whiting R, McDowell RM, Morales RA. An overview of the
       Salmonella enteritidis
risk assessment for shell eggs and egg products. Risk Anal 2002; 22: 203-218   PubMed

2      Xu C, Li ZS, Du YQ, Gong YF, Yang H, Sun B, Jin J. Construction of recombinant attenuated Salmonella typhimurium DNA
       vaccine expressing H pylori ureB and IL-2. World J Gastroenterol 2007; 13: 939-944   PubMed

3      Massi M, Ioan P, Budriesi R, Chiarini A, Vitali B, Lammers KM, Gionchetti P, Campieri M, Lembo A, Brigidi P. Effects of
       probiotic bacteria on gastrointestinal motility in guinea-pig isolated tissue. World J Gastroenterol 2006; 12: 5987-5994

        PubMed

4      Rodenburg W, Bovee-Oudenhoven IM, Kramer E, van der Meer R, Keijer J. Gene expression response of the rat small
       intestine following oral Salmonella infection. Physiol Genomics 2007; 30: 123-133   PubMed

5      Lai CW, Chan RC, Cheng AF, Sung JY, Leung JW. Common bile duct stones: a cause of chronic salmonellosis. Am J
       Gastroenterol
1992; 87: 1198-1199   PubMed

6      Dutta U, Garg PK, Kumar R, Tandon RK. Typhoid carriers among patients with gallstones are at increased risk for
       carcinoma of the gallbladder. Am J Gastroenterol 2000; 95: 784-787   PubMed

7      Prouty AM, Schwesinger WH, Gunn JS. Biofilm formation and interaction with the surfaces of gallstones by Salmonella
       spp. Infect Immun 2002; 70: 2640-2649   PubMed

8      Mastroeni P, Chabalgoity JA, Dunstan SJ, Maskell DJ, Dougan G. Salmonella: immune responses and vaccines. Vet J
      
2001; 161: 132-164   PubMed

9      Mittrucker HW, Kaufmann SH. Immune response to infection with Salmonella typhimurium in mice. J Leukoc Biol 2000;
       67: 457-463   PubMed

10    Barrow PA, Hassan JO, Lovell MA, Berchieri A. Vaccination of chickens with aroA and other mutants of Salmonella
       typhimurium and S. enteritidis. Res Microbiol 1990; 141: 851-853   PubMed

11    Gast RK, Beard CW. Production of Salmonella enteritidis-contaminated eggs by experimentally infected hens. Avian Dis
      
1990; 34: 438-446   PubMed

12    Agron PG, Walker RL, Kinde H, Sawyer SJ, Hayes DC, Wollard J, Andersen GL. Identification by subtractive hybridization
       of sequences specific for Salmonella enterica serovar enteritidis. Appl Environ Microbiol 2001; 67: 4984-4991   PubMed

13    Malorny B, Bunge C, Helmuth R. A real-time PCR for the detection of Salmonella Enteritidis in poultry meat and
       consumption eggs. J Microbiol Methods 2007; 70: 245-251   PubMed

14    Jothikumar N, Cromeans TL, Hill VR, Lu X, Sobsey MD, Erdman DD. Quantitative real-time PCR assays for detection of
       human adenoviruses and identification of serotypes 40 and 41. Appl Environ Microbiol 2005; 71: 3131-3136   PubMed

15    Kasai M, Francesconi A, Petraitiene R, Petraitis V, Kelaher AM, Kim HS, Meletiadis J, Sein T, Bacher J, Walsh TJ. Use of
       quantitative real-time PCR to study the kinetics of extracellular DNA released from Candida albicans, with implications for
       diagnosis of invasive Candidiasis. J Clin Microbiol 2006; 44: 143-150   PubMed

16    Kramer J, Visscher AH, Wagenaar JA, Boonstra-Blom AG, Jeurissen SH. Characterization of the innate and adaptive
       immunity to Salmonella enteritidis PT1 infection in four broiler lines. Vet Immunol Immunopathol 2001; 79: 219-233

        PubMed

17    Takata T, Liang J, Nakano H, Yoshimura Y. Invasion of Salmonella enteritidis in the tissues of reproductive organs in
       laying Japanese quail: an immunocytochemical study. Poult Sci 2003; 82: 1170-1173   PubMed

18    Desmidt M, Ducatelle R, Haesebrouck F. Research notes: Immunohistochemical observations in the ceca of chickens
       infected with Salmonella enteritidis phage type four. Poult Sci 1998; 77: 73-74   PubMed

19    Gast RK, Beard CW. Serological detection of experimental Salmonella enteritidis infections in laying hens. Avian Dis
      
1990; 34: 721-728   PubMed

20    Chart H, Rowe B, Baskerville A, Humphrey TJ. Serological analysis of chicken flocks for antibodies to Salmonella
       enteritidis
. Vet Rec 1990; 127: 501-502   PubMed

21    Oh YK, Alpuche-Aranda C, Berthiaume E, Jinks T, Miller SI, Swanson JA. Rapid and complete fusion of macrophage
       lysosomes with phagosomes containing Salmonella typhimurium. Infect Immun 1996; 64: 3877-3883   PubMed

22    Chowers Y, Cahalon L, Lahav M, Schor H, Tal R, Bar-Meir S, Levite M. Somatostatin through its specific receptor inhibits
       spontaneous and TNF-alpha- and bacteria-induced IL-8 and IL-1 beta secretion from intestinal epithelial cells. J Immunol
      
2000; 165: 2955-2961   PubMed

23    Leung KY, Finlay BB. Intracellular replication is essential for the virulence of Salmonella typhimurium. Proc Natl Acad Sci
       USA
1991; 88: 11470-11474   PubMed

24    Sheela RR, Babu U, Mu J, Elankumaran S, Bautista DA, Raybourne RB, Heckert RA, Song W. Immune responses against
       Salmonella enterica
serovar enteritidis infection in virally immunosuppressed chickens. Clin Diagn Lab Immunol 2003; 10:
       670-679   PubMed

25    Ohl ME, Miller SI. Salmonella: a model for bacterial pathogenesis. Annu Rev Med 2001; 52: 259-274   PubMed

26    Humphries AD, Townsend SM, Kingsley RA, Nicholson TL, Tsolis RM, Baumler AJ. Role of fimbriae as antigens and
       intestinal colonization factors of Salmonella serovars. FEMS Microbiol Lett 2001; 201: 121-125   PubMed

27    Jones BD, Falkow S. Salmonellosis: host immune responses and bacterial virulence determinants. Annu Rev Immunol
      
1996; 14: 533-561   PubMed

28    Humphrey TJ, Baskerville A, Chart H, Rowe B, Whitehead A. Salmonella enteritidis PT4 infection in specific pathogen
       free hens: influence of infecting dose. Vet Rec 1991; 129: 482-485   PubMed

29    Hsu HS. Pathogenesis and immunity in murine salmonellosis. Microbiol Rev 1989; 53: 390-409   PubMed

30    Nnalue NA, Shnyra A, Hultenby K, Lindberg AA. Salmonella choleraesuis and Salmonella typhimurium associated with
       liver cells after intravenous inoculation of rats are localized mainly in Kupffer cells and multiply intracellularly. Infect
       Immun
1992; 60: 2758-2768   PubMed

31    Vazquez-Torres A, Jones-Carson J, Baumler AJ, Falkow S, Valdivia R, Brown W, Le M, Berggren R, Parks WT, Fang
       FC. Extraintestinal dissemination of Salmonella by CD18-expressing phagocytes. Nature 1999; 401: 804-808   PubMed

32    Rescigno M, Borrow P. The host-pathogen interaction: new themes from dendritic cell biology. Cell 2001; 106: 267-270

        PubMed

33    Sierro F, Dubois B, Coste A, Kaiserlian D, Kraehenbuhl JP, Sirard JC. Flagellin stimulation of intestinal epithelial cells
       triggers CCL20-mediated migration of dendritic cells. Proc Natl Acad Sci USA 2001; 98: 13722-13727   PubMed

34    Abshire KZ, Neidhardt FC. Analysis of proteins synthesized by Salmonella typhimurium during growth within a host
       macrophage. J Bacteriol 1993; 175: 3734-3743   PubMed

35    Dunlap NE, Benjamin WH Jr, McCall RD Jr, Tilden AB, Briles DE. A 'safe-site' for Salmonella typhimurium is within splenic
       cells during the early phase of infection in mice. Microb Pathog 1991; 10: 297-310   PubMed

36    Cirillo DM, Valdivia RH, Monack DM, Falkow S. Macrophage-dependent induction of the Salmonella pathogenicity island 2
       type III secretion system and its role in intracellular survival. Mol Microbiol 1998; 30: 175-188   PubMed

37    Hensel M, Shea JE, Waterman SR, Mundy R, Nikolaus T, Banks G, Vazquez-Torres A, Gleeson C, Fang FC, Holden DW.
       Genes encoding putative effector proteins of the type III secretion system of Salmonella pathogenicity island 2 are
       required for bacterial virulence and proliferation in macrophages. Mol Microbiol 1998; 30: 163-174   PubMed

38    Vazquez-Torres A, Xu Y, Jones-Carson J, Holden DW, Lucia SM, Dinauer MC, Mastroeni P, Fang FC. Salmonella
       pathogenicity island 2-dependent evasion of the phagocyte NADPH oxidase. Science 2000; 287: 1655-1658   PubMed

39    Gilberthorpe NJ, Lee ME, Stevanin TM, Read RC, Poole RK. NsrR: a key regulator circumventing Salmonella enterica
       serovar Typhimurium oxidative and nitrosative stress in vitro and in IFN-gamma-stimulated J774.2 macrophages.
       Microbiology 2007; 153: 1756-1771   PubMed

40    Fang FC. Antimicrobial reactive oxygen and nitrogen species: concepts and controversies. Nat Rev Microbiol 2004; 2:
       820-832   PubMed

41    Zhang XL, Tsui IS, Yip CM, Fung AW, Wong DK, Dai X, Yang Y, Hackett J, Morris C. Salmonella enterica serovar typhi
       uses type IVB pili to enter human intestinal epithelial cells. Infect Immun 2000; 68: 3067-3073   PubMed

42    Bihl F, Salez L, Beaubier M, Torres D, Lariviere L, Laroche L, Benedetto A, Martel D, Lapointe JM, Ryffel B, Malo D.
       Overexpression of Toll-like receptor 4 amplifies the host response to lipopolysaccharide and provides a survival
       advantage in transgenic mice. J Immunol 2003; 170: 6141-6150   PubMed

43    Okamura M, Miyamoto T, Kamijima Y, Tani H, Sasai K, Baba E. Differences in abilities to colonize reproductive organs
       and to contaminate eggs in intravaginally inoculated hens and in vitro adherences to vaginal explants between Salmonella
       enteritidis and other Salmonella serovars. Avian Dis 2001; 45: 962-971   PubMed

44    Okamura M, Lillehoj HS, Raybourne RB, Babu US, Heckert RA, Tani H, Sasai K, Baba E, Lillehoj EP. Differential
       responses of macrophages to Salmonella enterica serovars Enteritidis and Typhimurium. Vet Immunol Immunopathol
       2005; 107: 327-335   PubMed

45    Mittrucker HW, Kohler A, Kaufmann SH. Characterization of the murine T-lymphocyte response to Salmonella enterica
       serovar Typhimurium infection. Infect Immun 2002; 70: 199-203   PubMed

46    van Velkinburgh JC, Gunn JS. PhoP-PhoQ-regulated loci are required for enhanced bile resistance in Salmonella spp.
       Infect Immun 1999; 67: 1614-1622   PubMed

47   Danese PN, Pratt LA, Kolter R. Exopolysaccharide production is required for development of Escherichia coli K-12 biofilm
       architecture. J Bacteriol 2000; 182: 3593-3596   PubMed

48    Rychlik I, Barrow PA. Salmonella stress management and its relevance to behaviour during intestinal colonisation and
       infection. FEMS Microbiol Rev 2005; 29: 1021-1040   PubMed

49    Snyder DS, Gibson D, Heiss C, Kay W, Azadi P. Structure of a capsular polysaccharide isolated from Salmonella
       enteritidis. Carbohydr Res 2006; 341: 2388-2397   PubMed

50    Davey ME, O'toole GA. Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 2000; 64: 847-867

        PubMed

51    De Medici D, Croci L, Delibato E, Di Pasquale S, Filetici E, Toti L. Evaluation of DNA extraction methods for use in
       combination with SYBR green I real-time PCR to detect Salmonella enterica serotype enteritidis in poultry. Appl Environ
       Microbiol 2003; 69: 3456-3461   PubMed

52    Livak KJ, Flood SJ, Marmaro J, Giusti W, Deetz K. Oligonucleotides with fluorescent dyes at opposite ends provide a
       quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl 1995; 4: 357-
       362   PubMed

 

S- Editor  Zhong XY    L- Editor  Alpini GD    E- Editor  Ma WH

 

 

 

 

 

Reviews Add
more>>


Related Articles:
Comparative analysis of intestinal microbial community diversity between healthy and orally infected ducklings with Salmonella enteritidis by ERIC-PCR
Quantitative studies of the regular distribution pattern for Salmonella enteritidis in the internal organs of mice after oral challenge by a specific real-time polymerase chain reaction
Application of an indirect immunofluorescent staining method for detection of Salmonella enteritidis in paraffin slices and antigen location in infected duck tissues
Gastrointestinal tract distribution of Salmonella enteritidis in orally infected mice with a species-specific fluorescent quantitative polymerase chain reaction
more>>