Qiang Deng, Ming Zhuang, Yu-Ying Kong, You-Hua Xie, Yuan Wang, State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes of Life Science, Chinese Academy of Sciences, Shanghai 200031, China
Qiang Deng, You-Hua Xie, Yuan Wang, Sino-France Center for Life Science and Genome Research
Supported by Basic Research Program from Ministry of Science and Technology of China, No. G1999054105, and special funds for Sino-France Center for Life Science and Genome Research from Chinese Academy of Sciences and Pasteur Institute in France
Co-correspondent: You-Hua Xie
Correspondence to: Yuan Wang, Institute of Biochemistry and Cell Biology, 320 Yue-Yang Road, Shanghai 200031,
China.  wangy@sibs.ac.cn
Telephone: +86-21-54921103    Fax: +86-21-54921011
Received: 2004-05-29    Accepted: 2004-07-11

Abstract
Aim: To construct a random peptide phage display library and search for peptides that specifically bind to the PreS region of hepatitis B virus (HBV).

Methods: A phage display vector, pFuse8, based on the gene 8 product (pVIII) of M13 phage was made and used to construct a random peptide library. E.coli derived thioredoxin-PreS was purified with Thio-bond beads, and exploited as the bait protein for library screening. Five rounds of bio-panning were performed. The PreS-binding specificities of enriched phages were characterized with phage ELISA assay.

Results: A phage display vector was successfully constructed as demonstrated to present a pVIII fused HBV PreS1 epitope on the phage surface with a high efficiency. A cysteine confined random peptide library was constructed containing independent clones exceeding 5±10⁸ clone forming unit (CFU). A pool of phages showing a PreS-binding specificity was obtained after the screening against thio-PreS with an enrichment of approximately 400 times. Five phages with high PreS-binding specificities were selected and characterized. Sequences of the peptides displayed on these phages were determined.

Conclusion: A phage library has been constructed, with random peptides displaying as pVIII-fusion proteins. Specific PreS-binding peptides have been obtained, which may be useful for developing antivirals against HBV infection.

ã 2005 The WJG Press and Elsevier Inc. All rights reserved.

Key words: Hepatitis B virus; Phage; Peptide

Deng Q, Zhuang M, Kong YY, Xie YH, Wang Y. Screening for PreS specific binding ligands with a phage displayed peptides library. World J Gastroenterol  2005; 11(26): 4018-4023
http://www.wjgnet.com/1007-9327/11/4018.asp

INTRODUCTION
The attachment to hepatocytes by hepatitis B virus (HBV) during infection has long been proposed to be a potential target for antiviral intervention. It is thought that molecules specifically binding to HBV particles may interfere with viral attachment and hence reduce or block subsequent infection^[1-3]. Ideally, these molecules should mimic the structural elements of a cell surface HBV receptor. Unfortunately, although a few host proteins have been demonstrated to interact with HBV particles or viral surface antigens, such a cell surface HBV receptor remains elusive^[4-8]. Consequently, our knowledge on the molecular events leading to HBV attachment to hepatocytes is very limited. One longstanding notion is the role of HBV PreS region in mediating HBV attachment to the putative receptor on hepatocytes^[8-11]. Specifically, the aa 21-47 segment within the PreS1 domain is believed to be essential for this process^[11]. It is noteworthy that other important functions of the PreS region have also been reported, for example, in the assembly and budding of HBV virion^[12-14]. Therefore, the PreS region has become a potential target for screening antivirals against HBV infection.
    Strategies for ligands discovery are usually based on procedures for assembling a large number of compounds to produce a diverse array of molecules, followed by a screening process against targets of interest. Among various technologies for ligand discovery, phage display has evolved into one of the main approaches for obtaining lead molecules^[15,16]. Filamentous phage M13 has a rather simple architecture composed of five different structure proteins. The product of gene 8 (pVIII) is a major capsid protein. There are approximately 2 700 pVIII molecules all over a phage particle, while other structural proteins are located at the tail of the phage particle with only a few copies of each^[17]. Thus, by fusing with pVIII, hundreds or thousands of ligands can theoretically be displayed on the surface of the phage particle, which should help strengthen its interaction with a target^[15,16]. Thus, pVIII fusion protein based phage display will offer a greater chance to find mildly binding ligands.
    In this study, we have constructed a structurally constrained phage display library in which random peptides are displayed as N-terminal fusions to pVIII and confined in a loop by a pair of flanking cysteine residues^[15,18,19]. Recombinant thio-PreS protein was used as target in screening for the PreS-binding peptides. A pool of phages showing PreS-binding specificity was obtained with an enrichment factor of approximately 400. Phages with high PreS-binding specificities were selected and characterized. Sequences of the peptides displayed on five of PreS-binding phages were determined.

MATERIALS AND METHODS
Materials
The pCANTAB5E vector, T7 DNA sequencing kit, and HRP-conjugated M13 specific monoclonal antibody (anti-M13 mAb) are products of Amersham Pharmacia Biotech (Piscataway, USA). XL1-blue F E.coli strain and helper phage VCSM13 were purchased from Stratagene (La Jolla, USA). PreS1 specific mAb 125E11 has been previously described^[20,21]. Maxisorp F16 module (Nunc, Denmark) was used for protein coating. Thiobond^TM affinity resin and the thioredoxin specific mAb (anti-thio) were from Invitrogen (Carlsbad, USA). Recombinant enterokinase (rEK) was purchased from Novagen (Madison, USA).

Construction of random peptide phage display library
pCANTAB5E was utilized as the parental vector for constructing a pVIII fusion protein display vector. The coding sequence for M13 pVIII was amplified with specific primers (pVIII-forward: 5'-TAAGGATCCGGTGGTGCT-GAGGGTGACGATCCCGC-3', pVIII-reverse: 5'-A GGAATTCATGTACCGTAACACTG-3') using the VCSM13 genome as template. PCR product was digested with BamHI and EcoRI, and inserted into the same sites in pCANTAB5E, replacing the original gene 3. The resulted vector was named pFuse8 (Figure 1A). To construct pFuse8-E that encodes a PreS1 epitope fused with pVIII (Figure 1A), annealed oligonucleotides (sense: 5'-CAGCAATGGCA-GGC AGCCTGAACCCTAGCTGGGATGGT GGCGGAGGATCCG-3', antisense: 5'-AATTCGGATC-CTCCGCCACC ATCCCAGCTAGGGTTCAGGCT GCCTGCCATTGCTGGCT-3', the epitope coding sequence is underlined) were ligated to pFuse8 digested with SfiI and BamHI.
    For the construction of peptide library, antisense oligonu-cleotides containing random nucleotides(5'-ATTGC-GGATCCACACC(MNN)3GCA(MNN)7ACA(MNN)3GCCTGCTGCCATTGCTGC-3', N = A, T, C or G; M = A or C) was synthesized (Invitrogen). A complementary primer (5'-CAGCAA TGGCAGCAGGC-3') was annealed to the 3 end of the long oligonucleotides, followed by the fill-in reaction with the Klenow polymerase to generate the double-stranded DNA. The DNA duplex was then digested with BamHI and ligated into pFuse8 cut with SfiI and BamHI. The ligation mixture was used to transform XL1-blue F competent cells by electroporation. The phage library was established by co-infection of helper phage VCSM13 (MOI, 10:1) to the transformed cells as previously described^[22]. Complexity of the library was estimated according to the number of independent transformed clones.

DNA sequencing
Phagemid pool of randomly picked-up clones from the library was prepared with SV minipreps kit (Promega). DNA sequencing was performed with T7 DNA sequencing kit according to the manufacturer's instruction.

Preparation of PreS fusion protein
Prokaryotic expression plasmid pThioHisA-PreS was constructed for the synthesis of thioredoxin fused PreS (thio-PreS) in E.coli^[23]. An affinity purification for the expression product was performed with ThiobondTM beads according to the manufacturer's instruction.

Library screening
Totally 10¹¹ phages were mixed with 30 mL of the thio-PreS bound ThiobondTM beads and incubated on a rotating wheel for 10 min. After washing with PBS containing 0.05% Tween 20 for four times, the beads were treated with 1 unit of rEK at 30 ℃ for 6 h. Phages binding specifically to the PreS region were supposed to detach off the beads. Eluted phages in the collected supernatant were subject to propagation in XL1-blue F cells, followed by VSCM13 co-infection to produce a phage pool for next round of panning^[22]. A total of five rounds of selection were performed.

Western blot
Western blot of thio-PreS was performed according to a standard method^[24]. Thio-PreS coupled on resins with or without rEK treatment were boiled and separated on SDS-PAGE, and transferred to nitrocellulose filters. Anti-thio mAb (1:1 000) was used as the primary antibody for the detection. Blots were developed using the ECL method with HRP-labeled rabbit anti-mouse Ig (1:2 000, DaKo, USA).

Phage ELISA
Phage ELISA was carried out as described previously^[22]. Purified thio-PreS proteins (1 mg/well) were immobilized on the microwells in PBS buffer overnight. Phages propagated from infected XL1-blue F cells were precipitated by 0.1 volume of PEG8000/NaCl (20% PEG8000, 3 mol/L NaCl), resuspended in PBS buffer and applied to thio-PreS coated wells, followed by an incubation at room temperature for 1 hour. An HRP-labeled anti-M13 mAb (1:1 000) was used for the detection of bound phages.

Virus capture assay
For capturing HBV virions, each microwell was coated with 10¹¹ phages in carbonate buffer (pH 9.5) at 4 ℃ overnight. After blocking with 1% BSA at 37 ℃ for 2 h, cultured medium of HepG2.2.15^[25] that contains HBV particles was added and incubated for 1 h at 37 ℃, followed by a washing process with PBS buffer containing 0.05% Tween 20. An HRP-conjugated anti-HBs antibody was used to detect the captured HBV particles according to the manufacturer's protocol (Sino-American Biotech, Shanghai).

RESULTS
Construction of pVIII based phage display vector
To construct the vector pFuse8, M13 gene 8 was amplified using the genomic DNA of VCSM13 phage as template. The PCR product was inserted into pCANTAB5E to replace the coding sequence of gene 3 and the E-tag (Figure 1A). The inserted gene 8 is located downstream to a leader signal sequence of gene 3, which is used to direct the pVIII fusion protein to the surface of the phage particle. In the phagemid pFuse8-E as shown in Figure 1B, a spacer between the leader signal and gene 8 encodes an in-frame peptide AAQPMAAG-SLNPSWD-GGGSGG. The first part of the peptide (AAQPMAAG) is a recognition sequence of the pelB signal peptidase^[26]. The 7-amino acids in the middle of this peptide represents an epitope within the HBV PreS1 domain that is recognized by the 125E11 mAb (unpublished data), providing a molecular marker for detection of phage display. The ensuing glycine tether is used to link the peptide to pVIII, increasing the flexibility of the peptide.
Phages were generated by co-infection of the pFuse8-E transformed XL1-blue F cells with helper phage VCSM13. The displayed 125E11 epitope was readily detected by phage ELISA in a dose dependent manner with the immobilized 125E11 mAb but not with an irrelevant mAb (anti-HBs) (Figure 2). As shown in Figure 2, the lac promoter employed in the vector was somewhat leaky so that pVIII-fused epitope could be easily detected even without IPTG induction^[27].

Table 1  Enrichment of phages binding to thio-PreS coupled beads

Round of panning	Thio-PreS coupled beads			Thioredoxin coupled beads
	Phage applied	Phage eluted	EF1	Phage applied	Phage eluted	EF
1st	2.0±1011	2.6±104	1.3±10-7	2.0±1011	3.4±104	1.7±10-7
2nd	1.0±1011	1.2±104	1.2±10-7	1.0±1011	9.5±103	9.5±10-8
3rd	1.0±1011	9.3±104	9.3±10-7	1.0±1011	3.9±104	1.2±10-7
4th	5.0±1010	3.5±105	7.0±10-6	5.0±1010	3.6±104	7.2±10-7
5th	5.0±1010	2.6±106	5.1±10-5	5.0±1010	8.8±104	1.8±10-6

¹Enrichment factor (EF) = phage eluted/phage applied.

Figure 1  (PDF) Diagram of library construction. A: a schematic representation of the steps in the construction of the phagemid encoding the pVIII fusion protein. pCANTAB5E, a pIII displaying vector; pFuse8, the vector harboring gene 8 coding sequence in replace of gene 3; pFuse8-E, the coding sequence for a specific epitope recognized by the 125E11 mAb is inserted into pFuse8; pFuse8-L, the coding sequences for random peptides are inserted into pFuse8; B: Inserted sequences in pFuse8-E and pFuse8-L after translation. SLNPSWD is the specific epitope recognized by the 125E11 mAb. In pFuse8-L, the epitope is replaced with X3CX7CX3.
Figure 2  (PDF) Surface display of the epitope recognized by 125E11. The SLNPSWD epitope displayed on the surface of the phage particle was detected by phage ELISA. The circles indicate the phages that bind 125E11 coated wells. Triangles represent phages captured by an irrelevant mAb (anti-HBs). The synthesis of pVIII fusion proteins with or without IPTG induction is denoted as white or black, respectively.

Construction of structure-confined random peptide phage display library
Structure-confined random peptide library has the advantage to present peptides in a fixed loop so that their conformations are relatively rigid^[18,19]. In this study, random peptides fused with pVIII assume a form of X3CX7CX3, where X stands for any amino acids. Two cysteine residues frank the 7 random amino acids in the middle. Under a non-reducing environment in the periplasm of E.coli, these cysteine residues may spontaneously form a disulfide bond that constrains the conformation of the displayed peptide^[18,19]. The oligonucleotides mixture coding for the random peptides was inserted into the pFuse8 vector (pFuse8-L, Figure 1A). The resulting library had the size of about 5.0×10⁸ independent clones that represented a great complexity. The random property of the library was verified by DNA sequence analysis. As shown in Figure 3, in the region coding for the random peptides, all four kinds of nucleotides are equally distributed at the first two positions of the triplet codons, while T or G varies at the third position, indicating a sufficient diversity of the library.

Screening for PreS-binding peptides
The PreS region of HBV, when synthesized alone in E.coli, is vulnerable to degradation and largely insoluble. To overcome these problems, the PreS region was fused with the C-terminus of thioredoxin (Figure 4A), which has dramatically enhanced both the stability and the solubility of the PreS region (Figure 4B). An enterokinase site located at the junction between the PreS region and the thioredoxin tag (Figure 4A) facilitates the release of the PreS region by digestion with rEK, leaving the thioredoxin tag on the affinity matrix (Figure 4C). Thus, the PreS-binding phages could be dissociated from the resin and enriched. It was expected that cleavage by rEK might decrease a nonspecific enrichment of phages binding to the thioredoxin tag. It is noteworthy that the degradation of the free PreS region should not influence the recovery of the PreS-binding phages.
    A total of five rounds of screening were performed. As shown in Table 1, the PreS-binding phages were greatly enriched as evidenced by a steadily rising enrichment factor (EF, phage eluted/phage applied). An approximately 400-fold of enrichment (EF5th/EF1^st) was achieved as estimated by the titer of the phages after the screening. The pool of phages from the final round of selection bound to the thio-PreS immobilized wells specifically in a dose-dependent manner, in sharp contrast to the original pool of phages before selection (Figure 5). A much weaker noise was noticed with the thioredoxin immobilized wells serving as a control, indicating that the thioredoxin-binding phages were also selected, though they might only be a small minority.

Figure 3  (PDF) Diversity of the constructed library. In the region coding for the random peptides, four kinds of nucleotides are equally distributed at the first two loci of the triplet codons, while T or G varies at the last. Oligonucleotides for cysteine confined random peptides (5’-GCAGCAGGC-(NNS)3-TGT(NNS)7-TGC(NNS)3-GGTGGTGGA-3’, N = A, T, C or G; S = A or C) are shown.
Figure 4  (PDF) Synthesis of thio-PreS. A: a schematic representation of the thio-PreS fusion protein, DDDDK is a cleavage site of rEK; B: SDS-PAGE analysis. Lane 1, the E.coli lysate without IPTG induction; lane 2, the soluble lysate after IPTG induction, thio-PreS of 33 ku is indicated with a triangle; lane 3, the purified thio-PreS; C: Western blot with the anti-thio mAb. Lane 1, thio-PreS coupled to the ThiobondTM beads; lane 2, thio-PreS coupled beads treated in the absence of rEK; lane 3, thio-PreS coupled beads treated in the presence of rEK.
Figure 5  (PDF) Phage ELISA of the enriched phages after the final round of screening. Black dots, the enriched phages bind to thio-PreS; Empty dots, the enriched phages bind to thioredoxin as a control; Black triangles, phages in the original library do not bind to thio-PreS.

Characterization of the PreS-binding phages
The specificity of the phages with regard to PreS-binding was further characterized by virus capture assay. When coated on microplate wells, the pool of phages from each round of selection was tested for their abilities to capture HBV virions from the cultured medium of HepG2.2.15. The binding capacity to HBV virions increased greatly after the final round of selection (Figure 6), suggesting that the PreS-binding phages were truly selected. Phages from the final round of selection were picked for a further analysis. The specificities of these phages with regard to PreS-binding were analyzed with phage ELISA assay. Phages with a strong binding capacity to thioredoxin were considered nonspecific and discarded (data not shown). The corresponding phagemids of five of the PreS-binding phages were subjected to DNA sequencing. Amino acid sequences of the potential PreS-binding peptides were deduced (Figure 7).

Figure 6  (PDF) Virus capture assay. The phage pool (10¹¹ CFU) after each round of screening shows an increasing binding capacity to HBV virions in the culture medium of HepG2.2.15.
Figure 7  (PDF) Amino acid sequences of PreS specific oligopeptides. The amino acid sequences of the peptides encoded by the phagemids derived from five of the PreS-binding phages were deduced from DNA sequencing analysis. The C in bold indicates the invariable residues of cysteines.

DISCUSSION
The filamentous phage display system, whereby the expressed peptides are displayed as fusions to phage coat proteins, has been effective in the discovery of ligands^[15,16]. Commonly exploited strategy is the surface display of N-terminus fusions to the minor coat protein pIII (product of phage gene 3). It represent a low-valent surface display, as only three to five copies of pIII are present at the tail of the phage particle, providing a selection platform for an interaction with a high affinity^[15]. In our work, a pVIII fusion protein based vector was successfully constructed, and proved to work well in peptide displaying. Since pVIII is a major coat protein with thousands of molecules on a single phage, thus pVIII fusion protein based phage display will offer a greater chance to find mildly or weakly binding ligands. As PreS-binding peptides are concerned, the pVIII fusion protein based system may be a better choice than the pIII fusion protein based system. It is supposed that the affinity of the HBV virion to its putative receptor on hepatocytes may not be strong, because an ensuing intracellular event of dissociation may occur closely after the penetration of the viral particle during the infection.
    Linear oligopeptides likely present various solution conformations that may be quite different from the structure in the native or bound forms of a protein. It has been demonstrated that the structurally active region in native protein may be mimicked by cyclic amino acid sequences of constrained peptides displayed on the phage surface^[15,18,19]. A pair of flanked cysteine residues was adopted to confine the random peptides in the middle by presumably forming an intra-molecular disulfide bond that provides a more defined scaffold when folded in the periplasmic environment of E.coli. In this study, we have constructed a conformation constrained random peptide phage display library and performed the screening with this library, in the hope that potential peptides with more defined conformations may better fulfill the structural features required for PreS-binding. On the other hand, such a conformation-constrained library has its weaknesses. It is likely that during the interaction process between PreS and a potential peptide, both partners may exert their influences on each other so that the conformation of the potential peptide adjusts to better bind PreS. In such a situation, the peptide with a constrained conformation may be too rigid to accommodate itself upon binding PreS, which will probably result in a reduced binding affinity.
    During the life cycle of HBV, the PreS region of the large surface antigen (LHBs) plays a crucial role in virion assembly and budding as well as in viral attachment to hepatocytes^[812,28,29]. Given the pivotal role of the PreS region in HBV life cycle, the specific PreS-binding ligands are expected to be useful as inhibitors to block viral entry to hepatocytes, or to interfere with the process of virion assembly in HBV infected cells. Similar ideas have been pursued widely in the field of HIV research and proved to be a potential way for antiviral drug development^[30,31]. Moreover, studies on the PreS-binding peptides will likely provide helpful information about the interaction between HBV virion and hepatocytes that may aid the identification of a yet-to-be-found receptor of HBV.
    The binding capacity of the pool of phages to HBV virions increased greatly after the final round of selection. Thus, the thio-PreS fusion protein was proved to be an 10 effective bait protein that might mimic the conformation adopted by the PreS region in the native virions. In addition, the affinity screening for the PreS-binding phages represents a promising approach for discovering HBV binding ligands. Several peptides encoded by the phagemids of five of the PreS-binding phages were determined. No consensus sequence or conserved amino acids were found in these five peptides. Therefore, these peptides likely bind to different fragments of the PreS region. On the other hand, sequences of more PreS-binding peptides need to be determined and the binding properties of the PreS-binding peptides await further investigations, which are currently on the way.

ACKNOWLEDGMENTS
125E11 is a kind gift from Professor Zhu-Chuan Zhang.

REFERENCES
1    Urban S, Gripon P. Inhibition of duck hepatitis B virus infection by a myristoylated pre-S peptide of the large viral 
      surface protein. J Virol 2002; 76: 1986-1990
2    Hong HJ, Ryu CJ, Hur H, Kim S, Oh HK, Oh MS, Park SY. In vivo neutralization of hepatitis B virus infection by 
      an anti-preS1 humanized antibody in chimpanzees. Virology 2004; 318: 134-141
3    Park SS, Ryu CJ, Gripon P, Guguen-Guillouzo C, Hong HJ. Generation and characterization of a humanized antibody 
      with specificity for preS2 surface antigen of hepatitis B virus. Hybridoma 1996; 15: 435-441
4    Stefas I, Rucheton M, D扐ngeac AD, Morel-Baccard C, Seigneurin JM, Zarski JP, Martin M, Cerutti M, Bossy JP, Misse 
      D, Graafland H, Veas F. Hepatitis B virus Dane particles bind to human plasma apolipoprotein H. Hepatology 2001; 
      33: 207-217
5    Ryu CJ, Cho DY, Gripon P, Kim HS, Guguen-Guillouzo C, Hong HJ. An 80-kilodalton protein that binds to the pre-S1 
      domain of hepatitis B virus. J Virol 2000; 74: 110-116
6    De Falco S, Ruvoletto MG, Verdoliva A, Ruvo M, Raucci A, Marino M, Senatore S, Cassani G, Alberti A, Pontisso P, 
      Fassina G. Cloning and expression of a novel hepatitis B virus-binding protein from HepG2 cells. J Biol Chem 2001; 
      276: 36613-36623
7    Gong ZJ, De Meyer S, van Pelt J, Hertogs K, Depla E, Soumillion A, Fevery J, Yap SH. Transfection of a rat hepatoma 
      cell line with a construct expressing human liver annexin V confers susceptibility to hepatitis B virus infection. 
      Hepatology 1999; 29: 576-584
8    De Meyer S, Gong ZJ, Suwandhi W, van Pelt J, Soumillion A, Yap SH. Organ and species specificity of hepatitis B 
      virus (HBV) infection: a review of literature with a special reference to preferential attachment of HBV to 
      human hepatocytes. J Viral Hepat 1997; 4: 145-153
9    Le Seyec J, Chouteau P, Cannie I, Guguen-Guillouzo C, Gripon P. Infection process of the hepatitis B virus depends on 
      the presence of a defined sequence in the pre-S1 domain. J Virol 1999; 73: 2052-2057
10    Pontisso P, Alberti A. The role of preS1 in the interaction of hepatitis B virus with human hepatocytes. Hepatology 
       1991; 14: 405-406
11    Neurath AR, Kent SB, Strick N, Parker K. Identification and chemical synthesis of a host cell receptor binding site 
       on hepatitis B virus. Cell 1986; 46: 429-436
12    Bruss V. A short linear sequence in the pre-S domain of the large hepatitis B virus envelope protein required for 
       virion formation. J Virol 1997; 71: 9350-9357
13    Ponsel D, Bruss V. Mapping of amino acid side chains on the surface of hepatitis B virus capsids required 
       for envelopment and virion formation. J Virol 2003; 77: 416-422
14    Poisson F, Severac A, Hourioux C, Goudeau A, Roingeard P. Both pre-S1 and S domains of hepatitis B virus 
       envelope proteins interact with the core particle. Virology 1997; 228: 115-120
15    Burritt JB, Bond CW, Doss KW, Jesaitis AJ. Filamentous phage display of oligopeptide libraries. Anal Biochem 
       1996; 238: 1-13
16    Sidhu SS. Phage display in pharmaceutical biotechnology. Curr Opin Biotechnol 2000; 11: 610-616
17    Cabilly S. The basic structure of filamentous phage and its use in the display of combinatorial peptide libraries. 
       Mol Bioechnol 1999; 12: 143-148
18    Hoess RH, Mack AJ, Walton H, Reilly TM. Identification of a structural epitope by using a peptide library displayed 
       on filamentous bacteriophage. J Immunol 1994; 153: 724-729
19    Luzzago A, Felici F, Tramontano A, Pessi A, Cortese R. Mimicking of discontinuous epitopes by 
       phage-displayed peptides, I. Epitope mapping of human H ferritin using a phage library of constrained peptides. 
       Gene 1993; 128: 51-57
20    Yang HL, Jin Y, Cao HT, Xu X, Li GD, Wang Y, Zhang ZC. Affinity purification of hepatitis B virus surface 
       antigen containing preS1 region. Shengwu Huaxue Yu Shengwu Wuli Xuebao 1996; 28: 412-417
21    Hui J, Li G, Kong Y, Wang Y. Expression and characterization of chimeric hepatitis B surface antigen particles 
       carrying preS epitopes. J Biotechnol 1999; 72: 49-59
22    Zhang XX, Deng Q, Zhang SY, Liu J, Cai Q, Lu ZM, Wang Y. Broadly cross-reactive mimotope of hypervariable 
       region 1 of hepatitis C virus derived from DNA shuffling and screened by phage display library. J Med Virol 2003; 
       71: 511-517
23    Deng Q, Kong YY, Xie YH, Wang Y. Expression and purification of the complete PreS region of hepatitis B Virus. 
       World J Gastroenterol 2005; 11: 3060-3064
24    Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: A laboratory manual.2nd ed. Cold Spring Harbor 
       Laboratory Press 1989:
25    Sells MA, Zelent AZ, Shvartsman M, Acs G. Replicative intermediates of hepatitis B virus in HepG2 cells that 
       produce infectious virions. J Virol 1988; 62: 2836-2844
26    Eerola R, Saviranta P, Lilja H, Pettersson K, Lovgren T, Karp M. Expression of prostate specific antigen on the surface 
       of a filamentous phage. Biochem BiophysRes Commun 1994; 200: 1346-1352
27    Crameri R, Jaussi R, Menz G, Blaser K. Display of expression products of cDNA libraries on phage surfaces. A 
       versatile screening system for selective isolation of genes by specific gene-product/ligand interaction. Eur J 
       Biochem 1994; 226: 53-58
28    Bruss V, Ganem D. The role of envelope proteins in hepatitis B virus assembly. Proc Natl Acad Sci USA 1991; 
       88: 1059-1063
29    Ponsel D, Bruss V. Mapping of amino acid side chains on the surface of hepatitis B virus capsids required 
       for envelopment and virion formation. J Virol 2003; 77: 416-422
30    Zhang X, Gaubin M, Briant L, Srikantan V, Murali R, Saragovi U, Weiner D, Devaux C, Autiero M, Piatier-Tonneau 
       D, Greene MI. Synthetic CD4 exocyclics inhibit binding of human immunodeficiency virus type 1 envelope to CD4 and 
       virus replication in T lymphocytes. Nat Biotechnol 1997; 15: 150-154
31    Choi YH, Rho WS, Kim ND, Park SJ, Shin DH, Kim JW, Im SH, Won HS, Lee CW, Chae CB, Sung YC. Short peptides 
       with induced beta-turn inhibit the interaction between HIV-1 gp120 and CD4. J Med Chem 2001; 44: 1356-1363

Science Editor Zhu LH  Language Editor Elsevier HK

Reviews	Add
more>>