|
Jin Lu,
Ya-Peng Gu, Xia Xu, Mei-Lian Liu, Ping Xie, Hui-Ping Song,
Department of Biochemistry, Xiangya School of Medicine, Central
South University, Changsha 410078, Hunan Province, China
Supported by the National Natural Science Foundation of
China, No. 30200136
Correspondence to: Professor Hui-Ping Song, Department of
Biochemistry, Xiangya School of Medicine, Central South University,
Xiangya Road, Changsha 410078 Hunan Province, China.
huiping_song@hotmail.com
Telephone: +86-731-2355115
Received: 2004-07-02
Accepted: 2004-09-09
Abstract
Aim: To establish
a model of islet-ductal cell transdifferen-tiation to identify the
transdifferentiated cells.
Methods:
Collagen was extracted from rat tail at first. Purified rat islets
were divided into three groups, embedded in collagen gel and
incubated respectively in DMEM/F12 alone (control group), DMEM/F12
plus epidermal growth factor (EGF), DMEM/F12 plus EGF and cholera
toxin (CT). Transdifferentiation was proved by microscopy, RT-PCR,
immunohistochemistry and RIA.
Results: Islets
embedded in collagen gel plus EGF and CT were cystically transformed
and could express new gene cytokeratin 19 while still maintaining
the expression of insulin and Pdx-1 genes. Immunohistochemistry
demonstrated that the protein of cytokeratin 19 was only expressed
in the third group. The insulin content secreted by islets in the
third group decreased significantly during the transdiffe-rentiation.
Conclusion: CT
is a crucial factor for the islet-ductal cell transdifferentiation.
ă 2005
The WJG Press and Elsevier Inc. All rights reserved.
Key words: Islets of Langerhans; Ductal cell;
Transdiffer-entiation
Lu J, Gu YP, Xu X, Liu ML, Xie P, Song HP. Adult islets cultured in
collagen gel transdifferentiate into duct-like cells. World J
Gastroenterol 2005;
11(22): 3426-3430
http://www.wjgnet.com/1007-9327/11/3426.asp
INTRODUCTION
Transdifferentiation is a process in which differentiated cells
alter their identity to become other distinct cell types. This
process has been proven by researches[1,2].
During pancreas development, both the exocrine and endocrine systems
seem to originate from the ductal cells which are considered as a
kind of pancreatic stem cells. This hypothesis is supported by the
phenomenon that ductal cells have the ability to transdifferentiate
into acinar cells and islets[3-5].
But this process is bilateral. On the contrary, acinar cells and
islets can transdifferentiate into duct-like cells[6,7].
It has also been reported that islets in a long-term culture can
transdifferentiate into exocrine and undifferentiated cells, which
may be considered as pancreatic precursor cells[8].
The process of mature endocrine cells transdifferentiating into
exocrine cells was also confirmed in our study. Our data show that,
rat islets cultured in rat tail collagen gel plus EGF and CT can
transdifferentiate into duct-like cells.
MATERIALS AND METHODS
Isolation and purification of islets
Male Sprague-Dawley (SD) rats, weighing 230-250 g, were obtained
from Central South University Laboratory Animal Department. For each
isolation, one rat was anesthetized with pentobarbital sodium (30
mg/kg) intraperitoneally. Isolation of pancreatic islets was
performed as previously described[9].
Briefly, after the output site of the duct from pancreas to duodenum
was clamped, the pancreas was distended maximally with 20 mL
collagenase (type IV, 1.5 mg/mL, Invitrogen) using a pulsed infusion
technique via the portal duct of pancreas. The whole pancreas was
removed from male SD rats and placed in a stationary water bath at
37 ℃
for 25 min to allow it to digest enzymatically. Digestate was
agitated gently for 1 min every 5 min during incubation. The
digestion process was stopped by adding 30 mL of cold Hank's
balanced salt solution (HBSS)
supplemented with 5% fetal bovine serum (FBS). After having vortexed
for 1 min to dissociate the islets from adherent acinar elements,
the mixture was passed through a steel mesh filter with an aperture
of 0.5 mm. The filtrate was subjected to the conventional method of
histopaque density gradient centrifugation to separate islets from
the digestion mixture.
DTZ staining and hand-picking
DTZ stock solution preparation
Ten milligrams of DTZ were dissolved entirely in 5 mL of
dimethyl sulfoxide (DMSO), then filtered through a 0.2-mm
nylon filter and stored briefly
at -20 ℃.
In vitro DTZ staining
Ten microliters of the stock solution was added to 1 mL
of culture medium. The culture dishes were incubated at 37 ℃
for 15 min in the DTZ solution. After the dishes were rinsed thrice
with HBSS, clusters stained crimson red were identified as islets.
These islets were hand-picked under a stereomicroscope. After
hand-picking, the dishes were refilled with DMEM containing 10% FBS.
The stain completely disappeared from the cells after 2 h.
Three-dimensional (3D) collagen gel matrix preparation and
islet culture
Collagen preparation Collagen was extracted from rat tail
tendons as previously described[10].
Tendons were excised from rat tails and sheared. Some connective
tissues were removed carefully, washed twice with PBS and then
soaked in 4 mmol/L acetic acid. After having stirred for two d at 4 ℃,
collagen was extracted. The extracts were centrifuged for 30 min at
10 000 g and supernatant was collected into another distilled
vessel for use. Protein concentration in the collagen was 1.0-1.5
mg/mL measured with an ultraviolet spectrophotometer.
Preparation of collagen gels Following sterile components
(0.7 mL 10×DMEM/F12, 0.1
mL heat-inactivated low-endotoxin FCS, 0.1 mL 0.1 mol/L NaOH, 0.1 mL
islet suspension) were carefully mixed to avoid bubbles. All
components required to make collagen gels were placed on ice except
for the islet suspension. Thus, the mixture resulted in a
physiologic ionic strength and 1×DMEM/F12 in
the final gel. The mixture was incubated at 37 ℃
in 50 mL/L CO2
and then gelation was completed after 60 min.
Islet culture Islets embedded in collagen gel were divided
into three groups and incubated under the following conditions.
3D culture alone (control group) DMEM/F12 (penicillin 100 U/mL, streptomycin 100 mg/mL,
10 mmol/L HEPES)+10% FCS+nicotinamide (10 mmol/L).
3D culture+EGF: DMEM/F12 (penicillin 100 U/ml,
streptomycin 100 mg/mL,
10 mmol/L HEPES)+10% FCS +EGF (100 ng/mL)+nicotinamide (10 mmol/L).
3D culture + EGF + CT: DMEM/F12 (penicillin 100
U/mL, streptomycin 100 mg/mL,
10 mmol/L HEPES)+10% FCS+EGF (100 ng/mL)+CT (100 ng/mL)+nicotinamide
(10 mmol/L).
Insulin content assay
Samples were taken at the 1st,
3rd,
5th,
16th,
28th,
40th,
52nd,
76th,
88th
,120th,
168th
h. After old culture medium was piped out thoroughly, islets were
rinsed twice and fresh medium was added. Culture media were sampled
after 1 h and frozen at -20 ℃.
Insulin content in samples was detected by radioimmunoassay (RIA).
Immunohistochemistry
Islets were hand-picked from slides pretreated with poly-L-lysine
and fixed in 4% paraformaldehyde (PFA). Then the fixed islets were
processed for routine histology and immun-ostained for insulin
(mouse anti-insulin, Boster, Wuhan) and cytokeratin 19 (mouse anti-cytokeratin
19, Boster, Wuhan) using the streptavidin-biotin complex (SABC)
method following the instructions of kit (Boster, Wuhan). For
cytokeratin 19, islet cells were pretreated with 0.1% trypsin. The
sections were incubated overnight at 4 ℃
with appropriate primary antibodies. Negative controls involved
omission of the primary antibodies.
RNA extraction and RT-PCR analysis
The collagen matrix was dissolved in 0.25 mg/mL collagenase and
islets were washed thrice. Total RNA was extracted from cultured rat
islets using TRIzol (GIBCO BRL) and reverse-transcribed into cDNA
with TaKaRa RNA PCR kit (AMV) Ver. 2.1 (TaKaRa, Japan) according to
the standard procedure. cDNA samples were subjected to PCR
amplification with specific primers. The cycling parameters were
pre-denaturation at 94 ℃
for 2 min, denaturation at 94 ℃
for 30 s, annealing at 55 ℃
for 30 s, and elongation at 72 ℃
for 1 min (34 cycles). Table 1 summarizes the sequences of the PCR
primers used in this study.
Table 1 Primers
used in study
| Targeted
mRNA |
Primer |
Length |
| Rat
Pdx-1 |
F:
gaggacccgtacagcctaca |
201
bp |
| |
R:
cgttgtcccgctactacgtt |
|
| Rat
Insulin |
F:
ccgtcgtgaagtggagga |
154
bp |
| |
R:
cagttggtagagggagcagat |
|
| Rat
Cytokeratin 19 |
F:
atccccaaagacacgagatg |
200
bp |
| |
R:
gtgagctacaaccgcagctt |
|
| Rat
b-actin |
F:
taaagagaagctgtgctatgttgc |
354
bp |
| |
R:
atgatcttgatcttcatggtgcta |
|
Statistical analysis
All data were expressed as mean±SD
with n = 3 at each time point. The difference between time
points with respect to insulin content was evaluated by one-way
ANOVA. P<0.05 was considered statistically significant.
RESULTS
Microscopy
We used DTZ to identify islets which were stained crimson while
acinar and ductal tissue failed to incorporate the stain. Islets
were stained with DTZ and hand-picked after density gradient
centrifugation. The stain completely disappeared from the cells
after 2 h (Figure 1).
Islets embedded in collagen gel could retain
their natural shape, while those in monolayer cultures could not
(Figure 2).
The islets in groups 1 and 2 were not different
in shape on d 1, 3 and 5. But some islets in group 3 continually
enlarged in these days (Figure 3). The percentage of islets
undergoing cystic transformation was increased over the time-course
of the culture period in group 3.
Figure 1 Islets
stained crimson with DTZ (A),
purified by density gradient separation and hand-picking (B),
and loss of color 2 h after islet staining (C)
(×100).
Figure 2 Shape
of islets culture in collagen gel (A
×100) and in monolayer (B
×200 ).
Figure 3 Islets
of group 3 cystic transformed gradually in the process of culture. A:
d 1 in culture; B:
d 3 in culture; C:
d 5 in culture (inverted microscope ×100).
Secreted insulin content
During the culture time, the abilities of islets to secrete insulin
in three groups were all decreased. Five hours later, islets lost
their secreting ability faster in group 3 than in groups 1 and 2 (P<0.05
or 0.01) (Figure 4).
Figure
4 (PDF) Insulin
contents in culture media of three groups at different time points
were detected using RIA. (aP<0.05:
group 1 vs group 3; bP<0.01:
group 1 vs group 3; cP<0.05:
group 2 vs group 3;
dP<0.01: group 2 vs group 3).
Immunohistochemistry
Islets cultured for 1, 3, 5 d were insulin positive and
cytokeratin 19 negative in groups 1 and 2.
In group 3, islets were insulin positive and
cytokeratin 19 negative on d 1. There was a decrease in expression
of insulin mainly in the center of islets and some islet cells
around the cystic spaces began to express protein cytokeratin 19 on
d 3. Only a few cells in the islets expressed insulin continually on
d 5, but most cells expressed cytokeratin 19 (Figures 5 and 6).
Figure
5 Islets of group 3
stained for insulin by immunocytochemistry. A:
d 1 (strongly stain); B:
d 3 (decreased stain); C:
d 5 (lightly stain). (DAB stain and counterstained with hematine
crystal ×100).
Figure 6 Islets
of group 3 stain for cytokeratin 19. A:
d 1 (did not stain); B:
d 3 (lightly stain); C:
d 5 (strongly stain).
Reverse transcription and polymerase chain reaction
Freshly isolated islets expressed islet characteristic genes (pdx-1
and insulin) but did not express duct characteristic gene (cytokeratin
19) (Figure 7). After incubation for 7 d, islets in the three groups
could express genes (insulin and pdx-1), but cytokeratin 19 was only
expressed in group 3 (Figure 8).
Figure
7 (PDF)
Pdx-1, insulin genes were expressed in freshly isolated
islets, but cytokeratin 19 was not expressed (lane 1: Pdx-1;
lane 2: Insulin; lane
3: b-actin;
lane 4: cytokeratin 19).
Figure
8
(PDF) Gene’s
expression of islets of three groups cultured for 7 d; A: all
of three groups expressed insulin; B: all of three groups
expressed pdx-1; C: only group 3 expressed CK19 which group 1
and group 2 did not express.
DISCUSSION
Cells of both the exocrine (acinar cells) and endocrine systems
(islet cells) seem to originate from the ductal cells. From
experiments in vitro it is evident that during development,
endocrine cells emerge from the pancreatic ducts and form aggregates
that eventually form islets of Langerhans. Teitelman et al.[11],
removed pancreatic rudiments from E11 mouse embryos and maintained
in culture, and found that pancreas (including exocrine and
endocrine tissues) regenerates in vitro from E11 pancreatic
ducts. Rosenberg et al.[12],
reported that partial obstruction of the pancreatic duct in adult
hamsters leads to islet cell differentiation from cells in the
interlobular ducts, followed by formation of new islets. More
recently, Susan Bonner-Weir et al.[5],
cultivated human adult pancreatic duct cells in vitro and
differentiated the duct cells into "cultivated
human islet buds" (CHIBs) which have the ability to secrete
glucose-response insulin.
On the other hand, islets can transdifferentiate
into duct-like cells. Human and dog islets embedded in collagen gel
and cultured in media plus EGF and CT for several days can transform
and express duct cell marker CK-19[7,13].
In this study, we isolated rat islets and incubated them in the same
conditions as above, and proved that rat islets could
transdifferentiate into duct-like cells.
Extracellular matrix (ECM) is one of the most
important components in creating cellular microenvironment. Among
the ECM components, collagen can provide cells with a bio-mimic
environment favorable for their reorganization, or maintenance of
the three-dimensional structure. The use of collagen gel as an
extracellular matrix material is an important part of the culture
system in our study. Collagen gel matrix can help promote or
maintain the differentiated state of cells in culture, such as liver
cells[14]
and mammary epithelial cells[15].
ECM may also promote the process of cell transdifferentiation[6,16].
Collagen plays an important role in the process. Islets cannot
transdifferentiate in agarose gel[13].
ECM is the necessary condition for transdifferentiation. In our
study, islets embedded in collagen gel without EGF and CT did not
express CK-19, consistent with the report by Wang et al.[13].
EGF can activate protein tyrosine kinase (PTK),
protein kinase C and increase intracellular Ca2+
concentration after binding to EGF receptor[17].
CT can activate adenylate cyclase, and result in the increase of
intracellular cAMP concentration[18].
It was reported that the process of cystic transformation requires
both an elevation of intracellular cAMP and the presence of ECM
proteins[13].
Both cAMP and Ca2+
are classic second messengers. Perhaps EGF and CT affect the signal
transduction of islet cells in two ways by increasing the
concentration of these messengers. In our study, we found that EGF
alone had no ability to initiate islet cell transdifferentiation,
but it could preserve islet's
function. It is supported by the
fact that both EGF and betacellulin are members of EGF-family of
cytokines, and betacellulin is a kind of beta-cell growth factor,
suggesting that EGF also can stimulate beta-cell growth.
In conclusion, the process of
transdifferentiation is promoted by cooperation of collagen matrix,
EGF and CT. But the exact mechanisms of interaction of these factors
remain to be fully elucidated.
REFERENCES
1
Ng YY, Huang TP, Yang WC, Chen ZP, Yang AH, Mu W,
Nikolic-Paterson DJ, Atkins RC, Lan HY.
Tubular epithelial-myofibroblast
transdifferentiation in progressive tubulointerstitial fibrosis in
5/6 nephrectomized
rats. Kidney Int 1998; 54:
864-876
2
Badorff C, Brandes RP, Popp R, Rupp S, Urbich C,
Aicher A, Fleming I, Busse R, Zeiher AM, Dimmeler
S. Transdiffer-entiation of
blood-derived human adult endothelial progenitor cells into
functionally active
cardiomyocytes. Circulation 2003;
107: 1024-1032
3
Bonner-Weir S, Baxter LA, Schuppin GT, Smith FE. A
second pathway for regeneration of adult exocrine and
endocrine pancreas. A possible
recapitulation of embryonic development. Diabetes 1993; 42:
1715-1720
4
Walker NI, Winterford CM, Kerr JF. Ultrastructure of
the rat pancreas after experimental duct ligation. II. Duct
and stromal cell proliferation,
differentiation, and deletion. Pancreas 1992; 7:
420-434
5
Bonner-Weir S, Taneja M, Weir GC, Tatarkiewicz K, Song
KH, Sharma A, O扤eil
JJ. In vitro cultivation of human
islets
from expanded ductal tissue. Proc Natl Acad Sci USA 2000;97:
7999-8004
6
Arias AE, Bendayan M. Differentiation of pancreatic
acinar cells into duct-like cells in vitro. Lab Invest
1993; 69: 518-530
7
Yuan S, Rosenberg L, Paraskevas S, Agapitos D, Duguid
WP. Transdifferentiation of human islets to pancreatic
ductal
cells in collagen matrix culture. Differentiation 1996; 61:
67-75
8
Schmied BM, Ulrich A, Matsuzaki H, Ding X, Ricordi C,
Weide L, Moyer MP, Batra SK, Adrian TE, Pour
PM.
Transdif-ferentiation of human islet cells in a long-term culture. Pancreas
2001; 23: 157-171
9
Inoue K, Gu Y, Shinohara S, Kogire M, Mitsuo M, Nakai
I, Hayashi H, Uchida K, Maetani S, Ikada Y. Isolation of adult
pig
islet. In vitro assessment and xenotransplantation. Int J
Pancreatol 1992; 12: 173-180
10
Mio T, Adachi Y, Romberger DJ, Ertl RF, Rennard SI.
Regulation of fibroblast proliferation in three-dimensional
collagen
gel matrix. In Vitro Cell Dev Biol Anim 1996; 32:
427-433
11
Teitelman G, Lee J, Reis DJ. Differentiation of
prospective mouse pancreatic islet cells during development in
vitro
and
during regeneration. Dev Biol 1987; 120: 425-433
12
Rosenberg L, Brown RA, Duguid WP. A new approach to
the induction of duct epithelial hyperplasia and
nesidioblastosis
by cellophane wrapping of the hamster pancreas. J Surg Res
1983; 35: 63-72
13
Wang R, Li J, Rosenberg L. Factors mediating the
transdif-ferentiation of islets of Langerhans to duct
epithelial-like
structures. J Endocrinol 2001; 171: 309-318
14
Rubin K, Hook M, Obrink B, Timpl R. Substrate adhesion
of rat hepatocytes: mechanism of attachment to
collagen
substrates. Cell 1981; 24: 463-470
15
Yang J, Larson L, Flynn D, Elias J, Nandi S.
Serum-free primary culture of human normal mammary epithelial
cells
in
collagen gel matrix. Cell Biol Int Rep 1982; 6:
969-975
16
Reh TA, Nagy T, Gretton H. Retinal pigmented
epithelial cells induced to transdifferentiate to neurons by laminin.
Nature
1987; 330: 68-71
17
Boonstra J, Rijken P, Humbel B, Cremers F, Verkleij A,
van Bergen en Henegouwen P. The epidermal growth
factor.
Cell Biol Int 1995; 19: 413-430
18
Holmgren J. Actions of cholera toxin and the
prevention and treatment of cholera. Nature 1981; 292:
413-417
Science
Editor Wang XL and Guo SY Language
Editor Elsevier HK
| |
PubMed
