Search Article Keyword  
PubMed Submission Abstarct PDF   Click Count: 1902 DownLoad Count: 646 

ISSN 1007-9327 CN 14-1219/R  World J Gastroenterol  2005 February 28;11(8):1200-1203

Human papillomavirus in squamous cell carcinoma of esophagus in a high-risk population

Mohammad Farhadi, Zahra Tahmasebi, Shahin Merat, Farin Kamangar, Dariush Nasrollahzadeh, Reza Malekzadeh


Mohammad Farhadi, Shahin Merat, Dariush Nasrollahzadeh, Reza Malekzadeh, Digestive Disease Research Center, Tehran University of Medical Sciences, Tehran, Iran
Zahra Tahmasebi, Department of Molecular Biology, Khatam Postgraduate Faculty, Tehran, Iran
Farin Kamangar, Cancer Prevention Studies Branch, US National Cancer Institute, Bethesda, MD, USA
Supported by the Digestive Disease Research Center, Tehran University of Medical Sciences
Correspondence to: Professor Reza Malekzadeh, Digestive Disease Research Center, Shariati Hospital, North Kargar Avenue, Tehran 14114, Iran.  malek@ams.ac.ir
Telephone: +98-21-8012992    Fax: +98-21-2253635
Received: 2004-02-11    Accepted: 2004-03-13

Abstract
Aim: To investigate the relation of human papillomavirus (HPV) and esophageal squamous cell carcinoma (ESCC) in Iranian patients as compared to normal controls.

Methods: Using MY09/MY11 consensus primers, we compared the prevalence of a HPV L1 gene in tumor tissues from 38 ESCC cases and biopsied tissues from 38 endoscopically normal Iranian individuals. We also compared the presence of HPV16 and HPV18 in the same samples using type-specific E6/E7 primers.

Results: Fourteen (36.8%) of the 38 ESCC samples but only 5 (13.2%) of the 38 control samples were positive for the HPV L1 gene (P = 0.02). Five (13.2%) of the ESCC samples but none of the control samples were positive for the HPV16 E6/E7 gene (P = 0.05). Three (7.9%) of the ESCC samples and 5 (13.2%) of the control samples were positive for the HPV18 E6/E7 gene (P = 0.71).

Conclusion: Our data are consistent with HPV DNA studies conducted in other high-risk areas for ESCC. HPV should be considered as a potential factor contributing to the high incidence of ESCC in Iran and other high-incidence areas of the world.

Ó 2005 The WJG Press and Elsevier Inc. All rights reserved.

Key words: Papillomavirus; Squamous cell carcinoma of esophagus; Population

Farhadi M, Tahmasebi Z, Merat S, Kamangar F, Nasrollahzadeh D, Malekzadeh R. Human papillomavirus in squamous cell carcinoma of esophagus in a high-risk population. World J Gastroenterol  2005; 11(8): 1200-1203
http://www.wjgnet.com/1007-9327/11/1200.asp

INTRODUCTION
The role of human papillomavirus (HPV) in the etiology of esophageal squamous cell carcinoma (ESCC) has been debated in the past 20 years. Oncogenic types of HPV, most notably HPV 16 and HPV 18, are recognized as the most significant risk factors of cervical cancer
[1]. A role of HPV in the etiology of cancers of vulva, anus, penis, and oropharyngeal cavity has also been established[2]. However, the role of HPV in the causation of ESCC remains controversial. Syrjanen first suggested a role of HPV in the etiology of ESCC in 1982, based on the observation of characteristic histological findings suggesting the presence of HPV in benign esophageal epithelia and malignant esophageal tumors[3]. Since then several studies have used a variety of techniques, including detection of HPV DNA in esophageal tumor tissues and serological methods, to examine the association between exposure to HPV and risk of ESCC[4]. The results of these studies are not consistent. Case series using polymerase chain reaction have found evidence of HPV in tumor tissues varying from 0 to 67%[4].
    It has been suggested that the high variation in HPV DNA results may partly be explained by geographic variation. Most studies, that did not detect HPV DNA in esophageal tumors, were conducted in low-risk areas of USA or Europe. However most studies in high-risk areas for ESCC (such as China, South Africa, and Japan) found that HPV had significantly higher percentages in esophageal tumors
[4].
    Iran is a very high-risk area for esophageal cancer
[5-8]. In some parts of northeastern Iran, the incidence rate of ESCC is reportedly over 100/100 000 person/year[5].
    In order to investigate the prevalence of HPV infection in ESCC in Iran, a country with high rates of ESCC, we evaluated the tumor tissues from patients with ESCC and normal esophageal tissues from age-matched controls for the presence of HPV DNA.

MATERIALS AND METHODS
Formalin-fixed paraffin-embedded tissue samples were collected from the patients undergoing surgery for ESCC in two hospitals in Tehran (Shariati, Mehr) from 1996 to 2001. One control per case was selected from consecutive patients referred to a private gastroenterology clinic in Tehran for symptoms of dyspepsia. Only subjects who had normal endoscopy (non-ulcer dyspepsia) and matched on age (5 years) with one of the case subjects were eligible to be controls. In the controls, two biopsies were taken from the middle third of the esophagus, about 30 cm from the incisor teeth.
    The presence of the representative tumor in selected paraffin blocks was confirmed by at least two pathologists before the blocks were further processed for HPV DNA.
    One block from each tumor and one block containing both biopsies from each control patient were evaluated for the presence of HPV L1 gene using MY09/MY11 consensus (general) primers. MY09/MY11 primers are complementary to 450-bp-conserved sequences in the L1 gene of HPV, and are able to amplify the L1 gene from a broad range of HPV types. In samples where the L1 gene could be amplified, further examination was performed to explore the presence of HPV16- and HPV18-specific E6/E7 genes.

DNA extraction
Serial tissue sections (3-5 sections, each 10-20-
mm thick) were cut from each paraffin block using disposable microtome blades. After rehydration, DNA was extracted using a lysis buffer containing 10 mmol/L Tris-HCl (pH 8), 100 mmol/L NaCl, 1% sodium docecyl sulfate, 200
mg/mL proteinase K, and 0.01% EDTA at 56 for 4 h and then incubated overnight at 37 in a lytic solution. After proteinase K digestion of the tissue, proteinase K was inactivated by incubation at 95 for 8-10 min. After vortex with phenol and 150 mL chloroform-isoamylalcohol and spun for 2 min at high speed, the upper phase was transferred to a new tube.

Sample suitability
Suitability of samples for PCR amplification was ascertained by testing for the beta-globin gene. Successful amplification of the beta-globin gene fragments indicated that the DNA sample was adequate for PCR analysis and that no PCR inhibitors were present.

Primers
To examine for the presence of any HPV DNA in the tissue, MY09/MY11 primer pairs were used to amplify the L1 gene. To look for HPV types 16 and 18, the type-specific primer pairs for the E6/E7 gene were used (Table 1). Distilled water was used as a negative control. This control was necessary to determine if any of the reagents was contaminated with HPV DNA.

Table 1  Primer sequences used for the amplification of HPV L1, HPV16 E6/E7, and HPV18 E6/E7 genes

Target

Primer sequence

Approximate size (bp)

HPV L1 gene(MY09)

5' CGTCC{C/A}A{G/A}{G/A}GGA{T/A}ACTGATC 3’

450

HPV L1 gene (MY11)

5' GC{C/A}CAGGG {T/A} CAT AA{T/C}AATGG 3’

450

HPV16 E6/E7 gene (sense)

5' GAACAGCAATACAACAAACCCG 3’

240

HPV16 E6/E7  gene (antisense)

5' CCATGCATGATTACAGCTGG 3’ 

240

HPV18 E6/E7 gene (sense) 

5' TGCCAGAAACCGTTGAATCC 3’ 

250

HPV18 E6/E7 gene (antisense)

5' CAATGTCTTGCAATGTTGCC 3’

250


Amplification
Master mixtures contained PCR buffer, 10 mmol/L Tris-HCl (pH 8.4), 50 mmol/L KCl, 2.5 mmol/L MgCl
2, 0.01% gelatin, 0.2 mmol/L of each dNTP (dATP, dCTP, dGTP and dTTP), 0.5 mmol/L of each primer and 2.5 units of Taq polymerase (Amp Taq). The PCR mixture was subjected to 30 cycles of amplification (using Genius thermal cycler) each consisting of an initial denaturing step at 94 for 1 min, annealing at 60 for 30 s and extension at 72 for 1 min.
    The PCR products were then detected by 2% agarose gel electrophoresis and visualized by ethidium bromide staining. Results were saved by a documentation system along with a transilluminator.

Statistical methods
We used the
c2 test or the Fisher exact test, wherever appropriate, to compare the proportions of cases and controls that were positive for HPV L1 gene and HPV16 and HPV18 (type-specific E6/E7 genes).
    The study protocol was approved by the Ethics Committee of the Digestive Disease Research Center, Tehran University of Medical Sciences, and informed consent was obtained from all controls before endoscopy.

RESULTS
Tissue samples were available from 40 cases of ESCC operated between 1996 and 2001. After DNA extraction, two samples were found unsuitable for PCR and excluded. The other 38 samples (22 males and 16 females) were included in the study as cases. Thirty-eight control subjects (16 males and 22 females), age-matched to cases, were selected from patients who were endoscopied for dyspepsia and had normal endoscopies. Mean  SD age was 54.213 years in cases (range 25-75 years), and 51.611.3 years in controls (range 22-78 years).
    Fourteen (36.8%) out of the 38 ESCC samples but only 5 (13.2%) of the 38 control samples were positive for 
HPV L1 gene (P = 0.02). Five (13.2%) of the ESCC samples but none of the control samples were positive for HPV16 E6/E7 gene (P = 0.05). Three (7.9%) of the ESCC samples and 5 (13.2%) of the control samples were positive for HPV18 E6/E7 gene (P = 0.71). No sample was positive for both HPV16 and HPV18.

DISCUSSION
ESCC has become the sixth most common cause of cancer death worldwide
[9]. In western countries, where the risk of ESCC is generally low, consumption of tobacco and alcohol could explain more than 90% of the cases of ESCC[6,10]. However, in countries with the highest rates of ESCC, such as Iran and China, only a small proportion of ESCC cases could be attributed to smoking or alcohol consumption[6,11]. So other risk factors must be responsible for the high incidence of ESCC in these areas. Microbial agents, especially HPV, may be one of the factors that explain part of this high incidence of ESCC.
    The etiologic role of oncogenic HPV types has been established in many epithelial cancers, most notably cervical cancer
[1,2]. Previous studies have shown that HPV16 and HPV18 are the most important risk factors for cervical cancer[1]. The mechanisms through which HPV can induce epithelial neoplasia have been extensively studied[12-15]. Some of the proteins produced by HPV, notably E6 and E7, are oncoproteins that could immortalize various human cell types, inactivate host proteins (such as p53 or pRb), and induce mutations in the host cell DNA[14,16,17].
    The role of HPV in ESCC has been studied in many high-risk and low-risk areas of the world
[4,18]. Most studies from high-risk areas, such as China and South Africa, have suggested a role of HPV in ESCC, while most studies from low-risk areas have failed to find any association[4,19-21]. To the best of our knowledge, this is the first study that reports the association between DNA markers of HPV and the risk of ESCC in Iran, a high-risk area for ESCC.
    Our results imply that HPV is not a predominant risk factor for ESCC in Iran because only 14 (36.8%) of 38 samples of ESCC were positive for the common indicator of HPV (L1 gene). However, this was higher than the percentage of positive samples in controls (13.2%) and the difference was statistically significant (P = 0.02). Higher prevalence of this HPV marker in ESCC cases than in controls may be confounded by other factors. But in the light of known mechanisms of carcinogenicity established for HPV and previous studies associating HPV with epithelial cancers, it is unlikely that the virus is a mere innocent bystander, and HPV should be considered as a potential factor contributing to high incidence of ESCC in Iran.
    The prevalence of HPV16 was significantly higher in ESCC cases than that in controls (P = 0.05), but there was no statistically significant difference in the prevalence of HPV18 between cases and controls. This implies that only HPV16, but not HPV18, may be a risk factor for ESCC in Iran. A similar Chinese study by Zhou et al. found a similar result. We found markers for HPV16 and HPV18 in only 8 out of 14 ESCC samples in which HPV L1 gene was present. Therefore, it is possible that other HPV types, not tested in this study, may also be associated with the risk of ESCC in this area. Another line of evidence that argues against high exposure of the Iranian population to HPV16 and HPV18, and hence against these two types of HPV being major risk factors for ESCC in Iran, is the low prevalence of cervical cancer in Iran
[7]. Low exposure to HPV16 and HPV18 in Iran is possibly related to the lifestyle and sexual behaviors in this religious society.
    A potential shortcoming of this study, as well as other retrospective studies, is their limited ability to find an association between HPV and ESCC, if HPV has a
"hit-and-run" mechanism for inducing ESCC, as some studies in a bovine model have suggested[22]. These studies have found that bovine papillomavirus is essential in the early stages of carcinogenesis of the bovine foregut, but is not needed for progression to the malignant state. Therefore, although we found evidence for the presence of HPV in only 38% of our case samples, it is possible that such evidence in other cases has disappeared. This hypothesis can only be tested in prospective studies with tissue or serum samples. So far, no prospective studies using tissue samples have examined this hypothesis, but two small prospective serologic studies have found a strong association between serologic HPV markers and the risk of ESCC[23,24].
    In summary, our data are consistent with HPV DNA studies conducted in other high-risk areas for ESCC which showed evidence of HPV in tumor tissues from 20% to 50% of ESCC cases. We think that HPV should be considered as a potential factor contributing to the high incidence of ESCC in Iran and other high-incidence areas of the world. Further prospective studies are needed to test the hypothesis of a
"hit-and-run" phenomenon, the hypothetical mechanism suggested for the disappearance of HPV from tumors after initial DNA damage.

REFERENCES
1    Munoz N, Bosch FX, de Sanjose S, Herrero R, Castellsague X, Shah KV, Snijders PJ, Meijer CJ. Epidemiologic 
      classification of human papillomavirus types associated with cervical cancer. N Engl J Med 2003; 348: 518-527
2    Gillison ML, Shah KV. Chapter 9: Role of mucosal human papillomavirus in nongenital cancers. 
      J Natl Cancer Inst Monogr 2003; 31: 57-65
3    Syrjanen K, Pyrhonen S, Aukee S, Koskela E. Squamous cell papilloma of the esophagus: A tumour probably caused 
      by human papilloma virus (HPV). Diagn Histopathol 1982; 5: 291-296
4    Syrjanen KJ. HPV infections and oesophageal cancer. J Clin Pathol 2002; 55: 721-728
5    Mahboubi E, Kmet J, Cook PJ, Day NE, Ghadirian P, Salmasizadeh S. Oesophageal cancer studies in the Caspian 
      Littoral of Iran: The Caspian cancer registry. Br J Cancer 1973; 28: 197-214
6    Munoz N, Day NE. Esophageal cancer In: Schottenfeld D, Fraumeni JF, eds. Cancer Epidemiology and Prevention. 
      New York: Oxford University Press 1996: 681-706
7    Sadjadi A, Malekzadeh R, Derakhshan MH, Sepehr A, Nouraie M, Sotoudeh M, Yazdanbod A, Shokoohi B, Mashayekhi A, 
      Arshi S, Majidpour A, Babaei M, Mosavi A, Mohagheghi MA, Alimohammadian M. Cancer occurrence in Ardabil: Results 
      of a population-based cancer registry from Iran. Int J Cancer 2003; 107: 113-118
8    Saidi F, Sepehr A, Fahimi S, Farahvash MJ, Salehian P, Esmailzadeh A, Keshoofy M, Pirmoazen N, Yazdanbod M, 
      Roshan MK. Oesophageal cancer among the Turkomans of northeast Iran. Br J Cancer 2000; 83: 1249-1254
9    Parkin DM, Bray F, Ferlay J, Pisani P. Estimating the world cancer burden: Globocan 2000. 
      Int J Cancer 2001; 94: 153-156
10    Brown LM, Hoover R, Silverman D, Baris D, Hayes R, Swanson GM, Schoenberg J, Greenberg R, Liff J, Schwartz A, 
       Dosemeci M, Pottern L, Fraumeni JF Jr. Excess incidence of squamous cell esophageal cancer among US Black men: 
       Role of social class and other risk factors. Am J Epidemiol 2001; 153: 114-122
11    Cook-Mozaffari PJ, Azordegan F, Day NE, Ressicaud A, Sabai C, Aramesh B. Oesophageal cancer studies in the 
       Caspian Littoral of Iran: Results of a case-control study. Br J Cancer 1979; 39: 293-309
12    zur Hausen H, de Villiers EM. Human papillomaviruses. Annu Rev Microbiol 1994; 48: 427-447
13    zur Hausen H. Papillomaviruses in human cancers. Proc Assoc Am Physicians 1999; 111: 581-587
14    zur Hausen H. Immortalization of human cells and their malignant conversion by high risk human 
       papillomavirus genotypes. Semin Cancer Biol 1999; 9: 405-411
15    Chen Hheng SB, Chew EC. Human papillomavirus 16 E6 is associated with the nuclear matrix of esophageal 
       carcinoma cells. World J Gastroenterol 2001; 7: 788-791
16    Mantovani F, Banks L. The interaction between p53 and papillomaviruses. Semin Cancer Biol 1999; 9: 387-395
17    Caldeira S, de Villiers EM, Tommasino M. Human papillomavirus E7 proteins stimulate proliferation independently 
       of their ability to associate with retinoblastoma protein. Oncogene 2000; 19: 821-826
18    Lavergne D, de Villiers EM. Papillomavirus in esophageal papillomas and carcinomas. Int J Cancer 1999; 80: 681-684
19    Kok TC, Nooter K, Tjong AHS, Smits HL, Ter Schegget JT. No evidence of known types of human papillomavirus in 
       squamous cell cancer of the oesophagus in a low-risk area. Rotterdam oesophageal tumour study group. 
       Eur J Cancer 1997; 33: 1865-1868
20    Chen B, Yin H, Dhurandhar N. Detection of human papillomavirus DNA in esophageal squamous cell carcinomas by 
       the polymerase chain reaction using general consensus primers. Hum Pathol 1994; 25: 920-923
21    Chang F, Syrjanen S, Shen Q, Cintorino M, Santopietro R, Tosi P, Syrjanen K. Human papillomavirus involvement 
       in esophageal carcinogenesis in the high-incidence area of China. A study of 700 cases by screening and type-specific 
       in situ hybridization. Scand J Gastroenterol 2000; 35: 123-130
22    Campo MS. Papillomas and cancer in cattle. Cancer Surv 1987; 6: 39-54
23    Dillner J, Knekt P, Schiller JT, Hakulinen T. Prospective seroepidemiological evidence that human papillomavirus 
       type 16 infection is a risk factor for oesophageal squamous cell carcinoma. BMJ 1995; 311: 1346
24    Bjorge T, Hakulinen T, Engeland A, Jellum E, Koskela P, Lehtinen M, Luostarinen T, Paavonen J, Sapp M, Schiller J, 
       Thoresen S, Wang Z, Youngman L, Dillner J. A prospective, seroepidemiological study of the role of human 
       papillomavirus in esophageal cancer in Norway. Cancer Res 1997; 57: 3989-3992
 

 

Reviews Add
more>>


Related Articles:
Loss of clusterin both in serum and tissue correlates with the tumorigenesis of esophageal squamous cell carcinoma via proteomics approaches
Translocation of annexin I from cellular membrane to the nuclear membrane in human esophageal squamous cell carcinoma
Overexpression of ETS2 in human esophageal squamous cell carcinoma
An analysis of esophageal cancer incidence in Cixian county from 1974 to 1996
Preoperative TN staging of esophageal cancer: Comparison of miniprobe ultrasonography, spiral CT and MRI
more>>