|
Jun
Liu, Ying-Hui Li, Jin Ding, Wei-Dong Gong, Cai-Fang Xue, Ya Zhao,
Yu-Xiao Huang, Department of Etiology, Fourth Military Medical
University, Xi’an 710032, Shaanxi Province, China
Supported by the National Natural Science Foundation of
China, No. 30100157; Medical Research Fund of Chinese PLA, No.
01MA184; Innovation Project of FMMU, No. CX99005
Co-correspondents: Cai-Fang Xue
Correspondence to: Dr. Jun Liu, Department of Etiology,
Fourth Military Medical University, Xi’an 710033, Shaanxi
Province, China. etiology@fmmu.edu.cn
Telephone: +86-29-83374536
Fax: +86-29-83374594
Received: 2004-03 -11
Accepted: 2004-04 -13
Abstract
AIM: To quantify the inhibition of HBV replication by targeted
ribonuclease by using real-time fluorescent PCR.
METHODS: Targeted ribonuclease was introduced into 2.2.15 cells by
liposome-mediated transfection or HIV-TAT mediated protein
transduction. Forty-eight hours after the transfection and 24 h
after the transduction, supernatants of 2.2.15 cells were collected
and HBV DNA in the supernatants was quantified by real-time
fluorescent PCR with a commercial kit.
RESULTS:
HBV DNA concentrations in the supernatants of 2.2.15 cells
transfected or transducted with targeted ribonuclease were 4.9±2.4×108
copies/L and 8.3±4.0×108
copies/L, respectively. Compared with controls, transfection or
transduction of targeted ribonuclease reduced HBV DNA concentration
in the supernatants of 2.2.15 cells by 90.4% and 90.1%, respectively
(P<0.05).
CONCLUSION:
Targeted ribonuclease can inhibit HBV replication in 2.2.15 cells.
Liu J, Li YH, Ding J,
Gong WD, Xue CF, Zhao Y, Huang YX. Quantifying anti-HBV effect of
targeted ribonuclease by real-time fluorescent PCR. World J
Gastroenterol 2004;
10(19): 2883-2885
http://www.wjgnet.com/1007-9327/10/2883.asp
INTRODUCTION
Chronic hepatitis B virus (HBV) infection is a major health
problem worldwide. Globally, more than 350 million people are
infected with HBV, and some of them will evolve into liver cirrhosis
and hepatocellular carcinoma (HCC). Current treatment regimens for
chronic HBV infection, including interferon-g,
lamivudine, adefovir, or different combinations of these drugs, have
only a limited long-term efficacy, but many adverse effects and drug
resistance[1,2]. Therefore, the exploration of novel
treatment strategies for HBV infection is both necessary and urgent.
In fact, many ingenious treatment strategies have been tested for
inhibition of HBV replication, such as antisense nucleotides,
ribozymes, intracellular antibodies, targeted nucleases, RNA
interference[3-13]. All of them can inhibit HBV
replication to various degrees.
To explore alternative treatment methods against HBV
infection, targeted ribonuclease (TN), a fusion protein of HBVc and
human eosinophil-derived neurotoxin (hEDN), was constructed and its
effect on HBV replication was tested. After the targeted
ribonuclease was introduced by transfection or transduction into
2.2.15 cells, a cell model of HBV infection, we found that it
significantly reduced the serological markers of HBV replication,
namely HBsAg and HBeAg, in the supernatants of 2.2.15 cells,
suggesting that the targeted ribonuclease could inhibit HBV
replication.
To
further characterize the anti-HBV effect of the targeted
ribonuclease, the HBV DNA was quantified in the supernatants of
2.2.15 cells treated by the targeted ribonuclease. Our results
showed that the targeted ribonuclease markedly reduced HBV DNA
concentration in the supernatants, which together with our previous
findings, demonstrate that HBV replication can be inhibited by
targeted ribonuclease.
MATERIALS
AND METHODS
Cell culture
2.2.15 cells, a human hepatoblastoma Hep G2 cell line stably
transfected by HBV genome, were cultured in Dulbecco’s modified
Eagle’s medium (DMEM, purchased from Gibco Life Technologies,
Grand Island, NY) supplemented with 100 mL/L fetal calf serum (Sijiqing
Biotech Company, Hangzhou, China).
Transfection
The
transfection methods were previously described[14].
Briefly, twenty-four hours before transfection, 2.2.15 cells were
seeded into a culture plate at the density of 2×108/L. LipofectamineTM 2000 reagent (Gibco Life
Technologies) was used for the transfection of 2.2.15 cells by p/TN,
p/TNm, p/hEDN, p/HBVc, pcDNA3.1 (-), or mock solution (DMEM plus
LipofectamineTM 2000 reagent containing no plasmid) according to the
manufacturer’s protocol. p/TN, p/TNm, p/hEDN and p/HBVc are the
eukaryotic expression plasmids for targeted ribonuclease,
point-mutated targeted ribonuclease without ribonuclease activity,
human eosinophil-derived neurotoxin, and HBV core protein,
respectively.
Transduction
2.2.15
cells were seeded into a culture plate at the density of 2×108/L.
Twenty-four hours later, purified recombinant proteins with protein
transduction domain, TAT-TN, TAT-TNm, TAT-hEDN, and TAT-HBVc were
added into the culture medium. For mock transduction, an equal
volume of DMEM instead of protein was added into the culture medium.
Real-time
fluorescent PCR
Forty-eight hours after transfection and 24 h after
transduction, the supernatants of 2.2.15 cells were collected and
HBV DNA in the supernatants was quantified by using fluorescent PCR
kit for quantification of HBV DNA (Daan Gene Company, Guangzhou,
China) according to the manufacturer’s protocol. PCR primers were:
P1: 'ATCCTGCTGCTATGCCTCATCTT3’, P2: 5’
ACAGTGGGGAAAGCCCTACGAA3’. The probe was
5’TGGCTAGTTTACTAGTGCCATTTTG3’. PCR reaction was analyzed by PE
5700 (Perkin Elmer, USA).
Statistical analysis
All data were analyzed by SPSS 10.0 software. Differences
were considered statistically significant when P<0.05.
RESULTS
HBV DNA in the supernatants of 2.2.15 cells transfected or
transducted with the targeted ribonuclease and controls was
quantified by real-time fluorescent PCR. The results are shown in
Figure 1. Compared with the controls, HBV DNA concentration in the
supernatant of 2.2.15 cells was markedly reduced by the targeted
ribonuclease, which was introduced into the cells by both pathways,
i.e. transfection and transduction. The transfected targeted
ribonuclease reduced HBV DNA concentration by 90.4% and the
transducted targeted ribonuclease by 90.1% (P<0.05).
Either hEDN or HBVc alone had no such an effect, indicating that it
was the fusion protein itself, i.e. the targeted ribonuclease, but
not its constituent molecules that exerted the anti-HBV effect.
Interestingly, TNm which was mutated at just one amino acid residue
(Lys113→Arg)
but had no ribonuclease activity as compared with TN, did not
decrease HBV DNA concentration either, suggesting that the
ribonuclease activity was needed in the anti-HBV effect of the
targeted ribonuclease. To exclude the possibility that the anti-HBV
effect of the targeted ribonuclease was due to nonspecific killing
of 2.2.15 cells, we also detected cell viability of the transfected
and transducted cells by MTT assay. The results showed that the
targeted ribonuclease had no adverse effects on cell viability and
proliferation as compared with controls (P>0.05, data not
shown).
Figure 1(PDF)
HBV DNA concentration in the supernatants of tranfected and
transducted 2.2.15 cells. A: HBV DNA concentration in the
supernatants of transfected 2.2.15 cells. TN, TNm, hEDN, HBVc,
pcDNA3.1 (-), and MOCK represent the supernatants collected from
2.2.15 cells transfected by p/TN, p/TNm, p/hEDN, p/HBVc, pcDNA3.1
(-), or mock solution (DMEM plus LipofectamineTM 2000 reagent
containing no plasmid), respectively. B: HBV DNA concentrations in
the supernatants of transducted 2.2.15 cells. TAT-TN, TAT-TNm, TAT-hEDN,
TAT-HBVc, and MOCK represent the supernatants collected from 2.2.15
cells transducted by purified proteins of TAT-TN, TAT-TNm, TAT-hEDN,
TAT-HBVc, or mock solution (DMEM), respectively.
DISCUSSION
Real-time fluorescent PCR is a simple, sensitive, specific and
precise method to quantitate nucleic acids over a vast dynamic range[15].
Due to these advantages, real-time fluorescent PCR has been widely
used in both basic research and clinical diagnosis to measure the
quantity of nucleic acids. As for HBV, real-time fluorescent PCR has
been used in monitoring viral load during the course of antiviral
treatment to evaluate the efficacy of the treatment and predict the
possibility of emergence of drug-resistant variants, in the analysis
of anti-HBV effect of small interfering RNA transfected into HBV-producing
cell lines, and in the study of HBV pathogenesis[10,16-19].
In the current research, we also used real-time fluorescent PCR to
precisely quantify HBV DNA in the supernatants of 2.2.15 cells to
detect the effect of the targeted ribonuclease on HBV replication.
The targeted ribonuclease reported here is a fusion protein against
HBV infection constructed by us, based on the principle of capsid-targeted
viral inactivation (CTVI)[5,20]. Our previous studies
showed that it significantly reduced HBsAg and HBeAg in the
supernatants of 2.2.15 cells, suggesting that the targeted
ribonuclease could inhibit HBV replication. In consistent with our
previous findings, in this study we observed the targeted
ribonuclease notably reduced HBV DNA in the supernatants of 2.2.15
cells. Taken together, these results demonstrate that the targeted
ribonuclease strongly inhibits HBV replication. The targeted
ribonuclease may therefore be one of the promising alternative anti-HBV
agents which are being studied in the pursuing of a satisfactory
treatment for chronic HBV infection.
Although
the precise mechanism of anti-HBV effect of targeted ribonuclease
still remains unknown and awaits further study, the principle of
capsid-targeted viral inactivation (CTVI) implies that it may
specifically recognize pregenomic RNA (pgRNA) of HBV, the template
for HBV replication, intracellularly by the HBVc domain of fusion
protein, and then degrades pgRNA by the hEDN domain. This will in
turn lead to a decrease in the replication of HBV DNA and synthesis
of viral proteins, which finally results in a reduction of
extracellular HBV DNA and viral proteins (HBsAg and HBeAg). In fact,
we have found that purified targeted ribonuclease can degrade RNA in
vitro (unpublished data) which supports this mechanism. Experiments
are ongoing in this laboratory to clarify the mechanism and to apply
the targeted ribonuclease to small animal models.
REFERENCES
1
Conjeevaram HS, Lok AS. Management of chronic hepatitis B. J
Hepatol 2003; 38(Suppl 1): S90-S103
2
Jaboli MF, Fabbri C, Liva S, Azzaroli F, Nigro G, Giovanelli
S, Ferrara F, Miracolo A, Marchetto S, Montagnani M,
Colecchia A, Festi D, Reggiani LB,
Roda E, Mazzella G. Long-term alpha interferon and lamivudine
combination therapy
in non-responder patients with anti-HBe-positive
chronic hepatitis B: Results of an open, controlled trial. World
J
Gastroenterol 2003; 9: 1491-1495
3
Li JG, Lian JQ, Jia ZS, Feng ZH, Nie QH, Wang JP, Huang CX,
Bai XF. Effect of ribozymes on inhibiting expression of HBV
mRNA in HepG2 cells. Shijie Huaren
Xiaohua Zazhi 2003; 11: 161-164
4
Lu YY, Wang L, Liu Y, Yu M, Li K, Wang YD, Zhang LX, Cheng J.
Inhibitory effect of HBcAg ScFv on hepatitis B virus.
Shijie Huaren Xiaohua Zazhi 2002; 10:
765-769
5
Beterams G, Nassal M. Significant interference with hepatitis
B virus replication by a core-nuclease fusion protein. J
Biol Chem 2001; 276: 8875-8883
6
Giladi H, Ketzinel-Gilad M, Rivkin L, Felig Y, Nussbaum O,
Galun E. Small interfering RNA inhibits hepatitis B virus
replication in mice. Mol Ther 2003;
8: 769-776
7
McCaffrey AP, Nakai H, Pandey K, Huang Z, Salazar FH, Xu H,
Wieland SF, Marion PL, Kay MA. Inhibition of hepatitis B
virus in mice by RNA interference.
Nat Biotechnol 2003; 21: 639-644
8
Shlomai A, Shaul Y. Inhibition of hepatitis B virus
expression and replication by RNA interference. Hepatology
2003; 37: 764-770
9
Hamasaki K, Nakao K, Matsumoto K, Ichikawa T, Ishikawa H,
Eguchi K. Short interfering RNA-directed inhibition of
hepatitis B virus replication. FEBS
Lett 2003; 543: 51-54
10
Ying C, De Clercq E, Neyts J. Selective inhibition of
hepatitis B virus replication by RNA interference. Biochem Biophys
Res Commun 2003; 309: 482-484
11
Chen Y, Du D, Wu J, Chan CP, Tan Y, Kung HF, He ML.
Inhibition of hepatitis B virus replication by stably
expressed
shRNA. Biochem Biophys Res Commun
2003; 311: 398-404
12
Konishi M, Wu CH, Wu GY. Inhibition of HBV replication by
siRNA in a stable HBV-producing cell line. Hepatology
2003;38: 842-850
13
Klein C, Bock CT, Wedemeyer H, Wustefeld T, Locarnini S,
Dienes HP, Kubicka S, Manns MP, Trautwein C. Inhibition of
hepatitis B virus replication in vivo
by nucleoside analogues and siRNA. Gastroenterology 2003; 125: 9-18
14
Liu J, Li YH, Xue CF, Ding J, Gong WD, Zhao Y, Huang YX.
Targeted ribonuclease can inhibit replication of hepatitis
B virus. World J Gastroenterol 2003;
9: 295-299
15
Klein D. Quantification using real-time PCR technology:
applications and limitations. Trends Mol Med 2002; 8: 257-260
16
Werle B, Cinquin K, Marcellin P, Pol S, Maynard M, Trepo C,
Zoulim F. Evolution of hepatitis B viral load and viral
genome sequence during adefovir
dipivoxil therapy. J Viral Hepat 2004;11: 74-83
17
Kohmoto M, Enomoto M, Yano Y, Otani S, Minamitani S, Tamori
A, Habu D, Takeda T, Shiomi S, Seki S, Arakawa T,
Nishiguchi S. Detection of serum
hepatitis B virus DNA by real-time quantitative polymerase chain
reaction (TaqMan
PCR) during lamivudine treatment:
comparison with three other assays. Hepatol Res 2003; 26: 125-133
18
Ide T, Kumashiro R, Koga Y, Tanaka E, Hino T, Hisamochi A,
Murashima S, Ogata K, Tanaka K, Kuwahara R, Sata M. A
real-time quantitative polymerase
chain reaction method for hepatitis B virus in patients with chronic
hepatitis B treated
with lamivudine. Am J Gastroenterol
2003; 98: 2048-2051
19
Wieland SF, Spangenberg HC, Thimme R, Purcell RH, Chisari FV.
Expansion and contraction of the hepatitis B virus
transcriptional template in infected
chimpanzees. Proc Natl Acad Sci U S A 2004; 101: 2129-2134
20
Natsoulis G, Boeke JD. New antiviral strategy using capsid-nuclease
fusion proteins. Nature 1991; 352: 632-635
Edited
by
Zhang
JZ and Wang XL Proofread
by Xu FM
| |
PubMed
