Zhi-Hong Su, Ji-Cheng Li, Department of Histology and Embryology, Zhejiang University Medical College, Hangzhou 310031, Zhejiang Province, China
Correspondence to: Dr. Ji-Cheng Li, Department of Histology and Embryology, Zhejiang University Medical College, Hangzhou 310031, Zhejiang Province, China.  lijc@mail.hz.zj.cn
Telephone: +86-571-87217451    Fax: +86-571-87217139
Received: 2004-02-02    Accepted: 2004-02-21

Abstract
AIM: To investigate the pathogenic mechanism of colon cancer at the molecular level and to elucidate the relationship between intercellular adhesion molecule-1 (ICAM-1) and nm23H₁ genes and Chinese patients with colon cancer.

METHODS: DNA was extracted from paraffin-embedded materials. Polymerase chain reaction-single strand conformation polymorphism (PCR-SSCP) was used to analyze MSI and LOH. Expression of ICAM-1 was detected by Envision immuno-histochemistry. Experimental results were analyzed with Leica-Qwin computer imaging techniques and SPSS software of statistics.

RESULTS: ICAM-1 expression of lymphatic endothelium was negative in normal colon and positive in colon cancer respectively. The number of lymphatics positive for ICAM-1 was gradually increased with degree of cancer invasion (P<0.01). In the group with metastasis of colon cancer, the number of lymphatics positive for ICAM-1 in lymph nodes was more than that in the group with no metastasis (P<0.01). The frequency of MSI, LOH and nm23H1 protein was 26.67%, 20.00% and 53.33% in colon cancer, respectively. In TNM staging, MSI (43.75%) and nm23H1 protein (81.25%) in stages I+II were detected more easily than the corresponding indexes (MSI: 7.14%, P<0.05 and nm23H1: 21.43%, P<0.01) in stages III+IV. By comparison, the frequency of LOH (35.71%) in stages III+IV was more than that of LOH (6.25%, P<0.05) in stages I+II. LOH exhibited a rising trend along with the Duke’s staging. nm23H₁ protein in the group of tubular adenocarcinoma (60.00%) was higher expressed than that in the group of mucoid adenocarcinoma (20.00%) (P<0.01), and exhibited a rising trend with the differentiation degrees of tubular adenocarcinoma. nm23H₁ protein in MSI positive group was higher expressed (75%) than that in MSI negative group (45.45%, P<0.05).

CONCLUSION: The expression of ICAM-1 in lymphatic vessels is beneficial to the judgement of the invasion and metastasis ability of colon cancer and the anti-tumor immunity function, and shows an important clinical significance in predicting lymphatic metastasis of colon cancer. MSI and LOH may separately control the development of sporadic colon cancer with different pathways. LOH mostly arises in the late period of sporadic colon cancer and endows a high aggressive and poor prognostic phenotype. By compassion, MSI may be an early period molecule marker for sporadic colon cancer, enhanced expression of nm23H₁ protein can effectively inhibit colon cancer metastasis and improve prognosis of sporadic colon cancer patients.

Su ZH, Li JC. Lymphatic metastasis and nm23H₁ genetic instability in Chinese colon cancer patients. World J Gastroenterol  2004; 10(19): 2800-2804
http://www.wjgnet.com/1007-9327/10/2800.asp

INTRODUCTION
Colon cancer is one of the common malignant tumors. A series of investigations have revealed that the main reason why it gives rise to death of patients lies in its invasiveness and metastasis^[1]. Therefore, preventing colon deterioration and decreasing the death rate of colon cancer is of great significance. So far, it has been known that many factors may have an influence on colon cancer, such as anti-oncogenes, adhesion molecular E-selectin and E-cadherin, vascular endothelial growth factor and matrix metal protein (MMP-2)^[2-5]. Among these factors, anti-oncogene and adhesion molecules have become the "hot spots" in research of colon cancer^[6-8].
      Intercellular adhesion molecule-1 (ICAM-1), an important transmembrane glycoprotein, is negatively expressed on endothelial cells of lymphatic vessels in normal conditions^{[9, 10]}. ICAM-1 could induce attachment of cells such as lymphocytes to endothelial cells of blood vessels, and traverse blood vessels, aggregate antigens and take part in immune and inflammatory reactions. When tumors appeared in the body, lymphatic vessels became the main pathway for tumor cells to be transferred as a result of their own permeability^[11]. In the process, recognition, adhesion, morphologic change and penetration between cells were involved. Vasse et al.^[12]. reported that breast cancer cells could over-express the specific ligands of ICAM-1 (lymphocyte function associated antigen 1, LFA-1). With the development of cancer, the expression of LFA-1 went to an ascending trend on cancer cells. All the results indicated that ICAM-1 might take part in the metastasis. How endothelial cells of lymphatic vessels express ICAM-1? Few reports are available about whether endothelial cells of lymphatics express ICAM-1 or not in cancer tissue and whether ICAM-1/LFA-1 take part in the process of cancer cells attached to endothelial cells of lymphatics and metastasis.
      nm23H₁ is one of the main anti-oncogenes. A great number of experiments indicated that inactivation of these genes, that is, genetic instability, resulted in metastasis^[13,14]. However, there were few researches of these genes on colon cancers^[15]. In order to further investigate the pathogenic mechanism of colon, we examined the instability of D17S396 of nm23H₁ in unrelated patients with the single strand conformation polymorphism analysis of polymerase chain reaction products (PCR-SSCP).

MATERIALS AND METHODS
Case selection and extraction of DNA
Thirty-two specimens were obtained during 2000 to 2002. There were 21 males and 11 females, aged 27-77 years. Twenty-seven cases were patients with tubular adenocarcinoma,  5 cases were patients with mucoid adenocarcinoma in histological types. A senior pathologist made the final diagnosis on the basis of histological examination. No patient received radioactive therapy, chemotherapy before operation. Fresh surgical tissue samples were fixed immediately in formaldehyde solution for 12-24 h and paraffin-embedded for PCR-SSCP and immunohistochemical assay.

DNA extraction
DNA was extracted according to the standard protocols.

PCR amplification
Designed primers were synthesized by Shanghai Shengyou Biology Company. The primer sequences were (sense) 5’- TTGACCGGGGTAGAGAACTC –3’, (antisense) 5’- TCTCAGTACTTCCCGTGACC –3’. PCR mixture contained 200 ng of template-DNA and PCR reaction buffer containing 50 mmol/L KCl, 10 mmol/L Tris-HCl (pH 8.4), 1.5 mmol/L MgCl₂, 0.5 mmol/L each of two fragment-specific primers, 100 mmol/L each of dATP, dGTP, dTTP and dCTP, and 2 units of Taq DNA polymerase (Shanghai Shengyou Biology Company) for a reaction volume of 50 mL. The conditions for all PCR amplifications were at 94 °C for 5 min for pre-denaturation, at 94 °C for 45 s, at 62 °C for 45 s and at 72 °C for 45 s. Amplification was carried out for 35 cycles with a final extension for 10 min at 72 °C. The amplified fragments were run in 1% agarose gel.

SSCP analysis
SSCP analysis of fragments was performed on a mini electropho-resis Unit (Bio-Rad Company, USA). Ten microlitre of the PCR product was diluted with 10 mL of sample buffer containing 90% formamide, 0.05% bromphenol blue dye and 0.05% xylene cyanol. The samples were heated at 100 °C for 8 min, transferred into an ice-cold water bath for 3 min, and analysed by 8% PAGE in 45 mmol/L-Tris-borate (pH8.0)/1 mmol/L-EDTA (TBE) buffer under 13 v/cm at 10 °C.

DNA silver staining
Gels were stained with silver as follows. Gels were firstly fixed in 100 mL/L alcohol for 10 min and then oxidized in 100 mL/L nitric acid for 3 min. After washed for 1 min with double distilled water, they were stained in 2 g/L silver nitric acid for 5 min and washed for 1 min with double distilled water. Gels showed appropriate color in 15 g/L anhydrous sodium carbonate and 4 mL/L formalin and then the reaction was terminated by 7.5 mL/L glacial acetic acid. Finally they were washed with double distilled water.

Immunohistochemical assay
Immunohistochemical study was performed using Envision method. Briefly, 5 mm thick sections of the tissue were deparaffinized and rehydrated. Endogenous peroxidase activity was blocked with 3% hydrogen peroxide for 20 min. After three times of rinsing with 0.01 mol/L phosphate-buffered saline (PBS) (pH = 7.4), the slides were incubated with 10% normal goat serum at room temperature for 10 min to block the nonspecific reaction, and incubated for two hours with anti-ICAM-1 antibody. After rinsed in PBS for five min, they were incubated with Envision complex for two hours at room temperature, and stained with DAB after washed in PBS.

Statistical analyses
The experimental results were expressed as mean±SD. The correlation was analyzed with SPSS 8.0 software. P value less than 0.05 was regarded as statistically significant.

RESULTS
Expression of ICAM-1 in lymphatic endothelial cells
In the submucosa of normal colon, there existed a few lymphatic vessels with large, irregular cavities and thin walls. Simple squamous epithelia lined on them had no expression of ICAM-1 (Figure 1A). But in the submucosa and peripheral area of colon cancer, the number of lymphatic vessels was increased. Significant differences existed between them (P<0.01) (Table1). The expression of lymphatic endothelial cell was positive for ICAM-1 in colon cancer (Figure 1B). With the degree of cancer invasion, lymphatic vessels positive for ICAM-1 showed an increasing trend (P<0.01) (Table 2). When cancer metastasis appeared in the peripheral lymph node, ICAM-1 was strongly expressed in endothelial cells of their peripheral lymphatic vessels, and the number of lymphatic vessels positive for ICAM-1 was to the highest (Table 2).

Table 1  Comparison of ICAM-1 expression between colon cancer and normal colon (mean±SD)

^aP<0.05, ^bP<0.01, vs normal colon group.

Table 2  ICAM-1 expression in colon cancer (mean±SD)

Table 3  Relationship between clinical pathological parameter and nm23H1 genetic instability in colon cancer (mean±SD)

^aP<0.05, bP<0.01, vs tubular adenocarcinoma group;  ^cP<0.05, ^dP<0.01 vs high differentiation group;  ^eP<0.05, ^fP<0.01, vs stage I+II group; ^gP<0.05, ^hP<0.01 vs A, B, C groups respectively.

Figure 1  Expression of ICAM-1 in lymphatic endothelial cells. A: Negative expression of ICAM-1 in the lymphatic endothelium (L) of normal colon and positive expression of ICAM-1 in blood vessel endothelium (arrow) (Envision, original magnification ×400); B: Positive expression of ICAM-1 in the lymphatic endothelium (arrow) of colon cancer (Ca) (Envision, original magnification ×400).
Figure 2(PDF) Positive D17S396 MSI, LOH and nm23H1 in 30 cases of colon cancer. A: Positive MSI (arrow-headed) with an additional allele band (1C) compared with normal tissue (1N); B: Positive MSI (arrow-headed) with a removed allele band (4C) compared with normal tissue (4N); C: Positive LOH (arrow-headed) with a lacked allele band (9C) compared with normal tissue (9N); D: Positive nm23H₁ protein (arrow-headed) in cytoplasm, and nucleoli and membranes (Envision, original magnification ×200).

Genetic instability at D17S396 of nm23H₁
Microsatellite fragments of D17S396 were amplified. The positive rate of D17S396 MSI (Figures 2A, B), LOH (Figure 2C) and nm23H₁ protein (Figure 2D) was 26.67%, 20.00% and 53.33% respectively in 30 cases of colon cancer (Table 3).
      MSI and LOH were independent of the histological type of colon cancer, the degree of differentiation and Duke’s stage were related to the clinical TNM stage. In TNM staging, the frequency of MSI (43.75%) in stages I+II was more than that in stages III+IV (7.14%, P<0.05). In contrast, LOH (35.71%) in stages III+IV was detected more easily than that (6.25%, P<0.05) in stages I+II. In addition, LOH exhibited an ascending trend with the Duke’s stage (P<0.01).

Expression of nm23H₁ protein
The positive rate of nm23H₁ protein was related with the histological type of colon cancer, differentiation degree and clinical stage. The expression of nm23H₁ protein in the group of tubular adenocarcinoma (60.00%) was apparently higher than that in the group of mucoid adenocarcinoma (20.00%, P<0.01), and exhibited a rising trend with the differentiation degrees of tubular adenocarcinoma (P<0.01). The positive rate of nm23H₁ in stages I+II (81.25%) was greater than that in stages III+IV (21.43%) (P<0.01). The same phenomenon occurred between the group positive for MSI (75%) and the group negative for MSI (45.45%) (P<0.05) (Table 4). However, LOH had no effect on the expression of nm23H₁ protein (Table 4). Computer imaging analysis showed that there was a difference among the groups in nm23H₁ protein expression level.

Table 4  Relationship between LOH, MSI and nm23 protein expression (mean±SD)

DISCUSSION
Metastasis, the spread of cells from primary neoplasms to distant sites and their growth at that location, is the most harmful aspect of cancer. Despite great improvements in early diagnosis, surgical techniques, general patient care, local and systemic adjuvant therapies, most deaths from cancer are attributable to metastases that are resistant to conventional therapies. During metastatic cascade, tumor cells interact with various host cells as well as extracellular matrices and basement membrane components including laminin, fibronectin, and type I collagen through certain adhesion molecules such as integrins. Such adhesive interactions may lead to the enhancement of survival, arrest, or invasiveness of tumor cells and is one of the most important events in the metastatic process^[14-17].
      Intercellular adhesion molecule-1 (ICAM-1) is a single tran-smembrane glycoprotein and has two patterns in the body. One is located on the endothelial cells of blood vessels and is consisted of outmembrane region, transmembrane region and cytoplasmic region. The other (sICAM-1) is soluble in serum and is consisted of extracellular domains and originates from leucocytes, endothelial cells and hepatocytes^[18-20]. The specific ligand of ICAM-1, LFA-1, can be expressed on the surfaces of leucocytes and lymphocytes. In normal conditions, ICAM-1/LFA-1 plays an important role in various immune responses.
       How ICAM-1 expresses when tumors appear in the body? In the present case, ICAM-1 was expressed on endothelial cells of lymphatic vessels in colon cancer. With the degree of cancer invasion, lymphatic vessels positive for ICAM-1 showed an increasing trend. When cancer metastasis appeared in peripheral lymph nodes, ICAM-1 was strongly expressed on endothelial cells of peripheral lymphatic vessels, and the number of lymphatic vessels positive for ICAM-1 was the highest. The results might give a hint that cancer cells can be transferred into lymphatic vessels in combination with LFA-1. Furthermore, sICAM-1 transformed from ICAM-1 could inhibit natural killer cells, which could activate lymphocytes and restrict major histocompatibility complex (MHC) to react with T cells and tumor cells, thus promoting tumor cells to escape^[21-23]. Therefore, sICAM-1 could strengthen and promote cancer cells to survive and transfer in lymphatic vessels when tumor metastasis occurred.
      Genetic instability is the main reason why tumors appear and transfer^[24-31]. MSI and LOH could induce canceration in the body. MSI was firstly found in hereditary non-polyposis colorectal cancer (HNPCC), and then in some kinds of sporatic tumors such as colon cancer, gastric cancer, uterus cancer, breast cancer, prostate cancer and pancreatic cancer. Our results showed that DNA from thirty Chinese patients at the site of D17S396 appeared microsatellite instability, the incidence was 26.67%. Subsequent experiments indicated that the incidence of MSI at the site of D17S396 in the stage of TNM I+II was greater than that in the stage of TNM III+IV, suggesting that MSI might be one of the markers for early colon cancer.
      In contrast to MSI, the incidence of LOH at the site of D17S396 increased with the degree of Duke stage. Therefore, our results made it clear that LOH of nm23H₁ appeared at the later stage of colon cancer, which endowed colon cancer with a high invasiveness and a poor prognosis.
      The expression of nm23H₁ has a negative relationship with tumor metastasis. Leone et al.^[32] found that nm23H₁ had a function on the prevention of tumor metastasis by inhibiting the ability of cancer cells to clone. With the degree of tumor stage, the expression of nm23H₁ decreased. Our results indicate that with the development of colon cancer, the expression of nm23H₁ decreases.

REFERENCES
1    Bodey B, Bodey B Jr, Siegel SE, Kaiser HE. Failure of cancer vaccines: the significant limitations of this approach to 
      immunotherapy. Anticancer Res 2000; 20: 2665-2676
2    Dudda JC, Simon JC, Martin S. Dendritic cell immunization route determines CD8+ T cell trafficking to inflamed skin: 
      role for tissue microenvironment and dendritic cells in establishment of T cell-homing subsets. J Immunol 
      2004; 172: 857-863 
3    Launay D, Peyrat JP, Verdiere A, Hornez L, Hatron PY, Hachulla E, Devulder B, Hebbar M. Multiplex reverse transcription 
      polymerase chain reaction assessment of sialyltransferase expression in peripheral blood mononuclear cells in systemic 
      sclerosis. J Rheumatol 2004; 31: 88-95
4    Perdikogianni CH, Dimitriou H, Stiakaki E, Markaki EA, Kalmanti M. Adhesion molecules, endogenous granulocyte 
      colony-stimulating factor levels and replating capacity of progenitors in autoimmune neutropenia of childhood. Acta 
      Paediatr 2003; 92: 1277-1283
5    Kwei S, Stavrakis G, Takahas M, Taylor G, Folkman MJ, Gimbrone MA Jr, Garcia-Cardena G. Early adaptive responses 
      of the vascular wall during venous arterialization in mice. Am J Pathol 2004; 164: 81-89
6    Benkoel L, Dodero F, Hardwigsen J, Benoliel AM, Bongrand P, Botta-Fridlund D, Le Treut YP, Chamlian A, Lombardo D. 
      Expression of intercellular adhesion molecule-1 (ICAM- 1) during ischemia-reperfusion in human liver tissue allograft: 
      image analysis by confocal laser scanning microscopy. Dig Dis Sci 2003; 48: 2167-2172
7    Nyska A, Moomaw CR, Ezov N, Shabat S, Levin-Harrus T, Nyska M, Redlich M, Mittelman M, Yedgar S, Foley JF. Ocular 
      expression of vascular cell adhesion molecule (VCAM-1) in 2-butoxyethanol-induced hemolysis and thrombosis in 
      female rats. Exp Toxicol Pathol 2003; 55: 231-236
8    Somersalo K, Anikeeva N, Sims TN, Thomas VK, Strong RK, Spies T, Lebedeva T, Sykulev Y, Dustin ML. Cytotoxic T 
      lymphocytes form an antigen-independent ring junction. J Clin Invest 2004; 113: 49-57
9    Chattopadhyay R, Taneja T, Chakrabarti K, Pillai CR, Chitnis CE. Molecular analysis of the cytoadherence phenotype of 
      a Plasmodium falciparum field isolate that binds intercellular adhesion molecule-1. Mol Biochem Parasitol 
      2004; 133: 255-265 
10  Einstein O, Karussis D, Grigoriadis N, Mizrachi-Kol R, Reinhartz E, Abramsky O, Ben-Hur T. Intraventricular 
      transplantation of neural precursor cell spheres attenuates acute experimental allergic encephalomyelitis. Mol Cell 
      Neurosci 2003;24: 1074-1082
11  Toyama H, Takada M, Suzuki Y, Kuroda Y. Brain death-induced expression of ICAM-1 and VCAM-1 on rat hepatocytes. 
      Hepatogastroenterology 2003; 50: 1854-1856
12  Vasse M, Thibout D, Paysant J, Legrand E, Soria C, Crepin M. Decrease of breast cancer cell invasiveness by sodium 
      phenylacetate (NaPa) is associated with an increased expression of adhesive molecules. Br J Cancer 2001; 84: 802-807
13  Soufir N, Daya-Grosjean L, de La Salmoniere P, Moles JP, Dubertret L, Sarasin A, Basset-Seguin N. Association between 
      INK4a-ARF and p53 mutations in skin carcinomas of xeroderma pigmentosum patients. J Natl Cancer Inst 
      2000; 92: 1841-1847
14  Berney CR, Fisher RJ, Yang J, Russell PJ, Crowe PJ. Genomic alterations (LOH, MI) on chromosome 17q21-23 and 
      prognosis of sporadic colorectal cancer. Int J Cancer 2000; 89: 1-7
15  Chow NH, Liu HS, Chan SH. The role of nm23H1 in the progression of transitional cell bladder cancer. Clin Cancer Res 
      2000; 6: 3595-3599
16  Kawamura A, Miura S, Murayama T, Iwata A, Zhang B, Nishikawa H, Tsuchiya Y, Matsuo K, Tsuji E, Saku K. Increased 
      Expression of Monocyte CD11a and intracellular adhesion molecule-1 in patients with initial atherosclerotic coronary 
      stenosis. Circ J 2004; 68: 6-10
17  Burns S, Hardy SJ, Buddle J, Yong KL, Jones GE, Thrasher AJ. Maturation of DC is associated with changes in motile 
      characteristics and adherence. Cell Motil Cytoskeleton 2004; 57: 118-132
18  DesJardin LE, Kaufman TM, Potts B, Kutzbach B, Yi H, Schlesinger LS. Mycobacterium tuberculosis-infected human 
      macrophages exhibit enhanced cellular adhesion with increased expression of LFA-1 and ICAM-1 and reduced 
      expression and/or function of complement receptors, FcgammaRII and the mannose receptor. Microbiology 
      2002; 148(Pt 10): 3161-3171
19  Masamune A, Sakai Y, Kikuta K, Satoh M, Satoh A, Shimosegawa T. Activated rat pancreatic stellate cells express 
      intercellular adhesion molecule-1 (ICAM-1) in vitro. Pancreas 2002; 25: 78-85
20  Becker A, van Hinsbergh VW, Jager A, Kostense PJ, Dekker JM, Nijpels G, Heine RJ, Bouter LM, Stehouwer CD. Why is 
      soluble intercellular adhesion molecule-1 related to cardiovascular mortality? Eur J Clin Invest 2002; 32: 1-8
21  Rescigno M, Valzasina B, Bonasio R, Urbano M, Ricciardi-Castagnoli P. Dendritic cells, loaded with recombinant bacteria 
      expressing tumor antigens, induce a protective tumor-specific response. Clin Cancer Res 2001; 7(3 Suppl): 865S-870S
22  Zhou Y, Bosch ML, Salgaller ML. Current methods for loading dendritic cells with tumor antigen for the induction of 
      antitumor immunity. J Immunother 2002; 25: 289-303 
23  Ishigami S, Natsugoe S, Tokuda K, Nakajo A, Xiangming C, Iwashige H, Aridome K, Hokita S, Aikou T. Clinical impact 
      of intratumoral natural killer cell and dendritic cell infiltration in gastric cancer. Cancer Lett 2000; 159: 103-108
24  Storchova Z, Pellman D. From polyploidy to aneuploidy, genome instability and cancer. Nat Rev Mol Cell Biol 
      2004; 5: 45-54
25  Ko EC, Wang X, Ferrone S. Immunotherapy of malignant diseases. Challenges and strategies. Int Arch Allergy Immunol 
      2003; 132: 294-309
26  Kleist B, Junghans D, Lorenz G, Bankau A, Poetsch M. The supplementary diagnostic power of selected 
      immunohistochemical, molecular genetic and infective parameters in epithelial hyperplastic laryngeal lesions. Oncology 
      2003; 65: 347-354
27  Kovesi G, Szende B. Changes in apoptosis and mitotic index, p53 and ki67 expression in various types of oral 
      leukoplakia. Oncology 2003; 65: 331-336
28  Hayashi H, Furihata M, Kuwahara M, Kagawa S, Shuin T, Ohtsuki Y. Infrequent alteration in the P53R2 gene in human 
      transitional cell carcinoma of the urinary tract. Pathobiology 2004; 71: 103-106
29  Bai Y, Murnane JP. Telomere instability in a human tumor cell line expressing NBS1 with mutations at sites 
      phosphorylated by ATM. Mol Cancer Res 2003; 1: 1058-1069
30  Alexander J, Watanabe T, Wu TT, Rashid A, Li S, Hamilton SR. Histopathological identification of colon cancer with 
      microsatellite instability. Am J Pathol 2001; 158: 527-535
31  Rouba A, Kaisi N, Al-Chaty E, Badin R, Pals G, Young C, Worsham MJ. Patterns of allelic loss at the BRCA1 locus in 
      Arabic women with breast cancer. Int J Mol Med 2000; 6: 565-569 
32  Leone A, Flatow U, van Houtte K, Steeg PS. Transfection of human nm23-H1 into the human MDA-MB-435 breast 
      carcinoma cell line: effects on tumor metastatic potential, colonization and enzymatic activity. Oncogene 
      1993; 8: 2325-2333

   Edited by Wang XL and Zhang JZ  Proofread by Xu FM  

Reviews	Add
more>>