Jie Sun, Jian-Guo Xu, Department of Anesthesiology, Jinling Hospital, College of Medicine, Nanjing University, Nanjing 210002, Jiangsu Province, China
Xiao-Dong Wang, Department of Surgery, Jinling Hospital, College of Medicine, Nanjing University, Nanjing 210002, Jiangsu Province, China
Hong Liu, Department of Chest Surgery, Jinling Hospital, College of Medicine, Nanjing University, Nanjing 210002, Jiangsu Province, China
Correspondence to: Professor Jian-Guo Xu, Department of Anesthesiology, Jinling Hospital 305 East Zhongshan Road, Nanjing 210002, Jiangsu Province, China.  dgsunjie@hotmail.com
Telephone: +86-25-4806839    Fax: +86-25-4803956
Received: 2003-10-08    Accepted: 2003-12-16

Abstract
AIM: To investigate the protective effect of ketamine on the endotoxin-induced proinflammatory cytokines and NF-kappa B activation in the intestine.

METHODS: Adult male Wistar rats were randomly divided into 6 groups: (a) normal saline control, (b) challenged with endotoxin (5 mg/kg) and treated by saline, (c) challenged with endotoxin (5 mg/kg) and treated by ketamine (0.5 mg/kg), (d) challenged with endotoxin (5 mg/kg) and treated by ketamine (5 mg/kg ), (e) challenged with endotoxin (5 mg/kg) and treated by ketamine (50 mg/kg), and (f) saline injected and treated by ketamine (50 mg/kg). After 1, 4 or 6 h, TNF-a and IL-6 mRNA were investigated in the tissues of the intestine (jejunum) by RT-PCR. TNF-a and IL-6 were measured by ELISA. We used electrophoretic mobility shift assay (EMSA) to investigate NF-kappa B activity in the intestine.

RESULTS: NF-kappa B activity, the expression of TNF-a and IL-6 were enhanced in the intestine by endotoxin. Ketamine at a dose of 0.5 mg/kg could suppress endotoxin-induced TNF-a mRNA and protein elevation and inhibit NF-kappa B activation in the intestine. However the least dosage of ketamine to inhibit IL-6 was 5 mg/kg in our experiment.

CONCLUSION: Ketamine can suppress endotoxin-induced production of proinflammatory cytokines such as TNF-a and IL-6 production in the intestine. This suppressive effect may act through inhibiting NF-kappa B.

Sun J, Wang XD, Liu H, Xu JG. Ketamine suppresses intestinal NF-kappa B activation and proinflammatory cytokine in endotoxic rats. World J Gastroenterol  2004; 10(7): 1028-1031
http://www.wjgnet.com/1007-9327/10/1028.asp

INTRODUCTION
Gram-negative bacteria caused sepsis remains an important cause of morbidity and mortality in septic and endotoxemic patients. Lipopolysaccharide (LPS), or endotoxin, a major component of the outer surface of Gram-negative bacteria, is a potent activator of cells of the immune and inflammatory systems, including macrophages, monocytes and endothelial cells^[1], and contributes to the systemic changes seen in septic shock^[1-4]. The endotoxic shock syndrome is characterized by systemic inflammation, multiple organ damage, circulatory collapse and death^[1,2].
    The important role of the intestinal mucosa in the inflammatory and metabolic responses to sepsis, severe injury and other critical illnesses has been increasingly recognized during the last decade. Thus, there is evidence that the gut mucosa becomes the site for production of various inflammatory cytokines^[5,6] and other yet unidentified substances that may influence not only the mucosa itself but also the function and integrity of remote organs and tissues^[7,8]. Indeed, the gut mucosa has been proposed to be the “motor” of multiple organ failure in critical illness^[9]. Besides, sepsis and severe injury are also associated with loss of mucosal integrity, resulting in increased permeability and bacterial translocation. These changes may accelerate the development of multiple organ failure^[10].
      Ketamine, an intravenous anesthetic, has been advocated for anesthesia in septic or severely ill patients because of its cardiovascular stimulating effects^[11,12]. And several previous studies reported that ketamine could suppress LPS-induced tumor necrosis factor alpha (TNF-a) production in the serum and reduced mortality in carrageenan-sensitized endotoxin shock mice^[13,14]. However, few studies were undertaken to investigate the protective effect of ketamine on the inflammatory response in the intestine during septic shock in vitro. Since local produced cytokines were regarded as the contributing factors in tissue damage during sepsis^[15-17]. And nuclear factor kappa B (NF-kappa B) was verified to be an inducible transcription factor that was required for the transcription of some proinflammatory cytokines such as TNF-a, interleukin 6 and interleukin 8 (IL-6 and IL-8)^[18]. Our previous study indicated that ketamine could inhibit endotoxin induced NF-kappa B and TNF-a in vitro^[19]. Therefore, this study was to investigate whether ketamine could suppress endotoxin-induced NF-kappa B activation and proinflammatory cytokines in the intestine in vitro in order to define a possible mechanism of the anti-inflammatory effect of ketamine.

MATERIALS AND METHODS
Animals and treatment
Adult male Wistar rats (250-300 g body mass) used in this experiment were purchased from Shanghai Animal Center, Shanghai, China. The rats were exposed each day to 12 h of light and darkness respectively. The experimental protocol followed the institution’s criteria for the care and use of laboratory animals in research. Further, all animals received humane care in compliance with Institutional Animal Care Committee.

Experimental protocol
The Wistar rat endotoxemia model was established by injection with a dose of LPS (5 mg/kg, Escherichia coli O111: B4) (Sigma Chemical Co., USA) via the tail vein. Then all animals were immediately treated with different doses of ketamine (0.5, 5, 50 mg/kg) or normal saline (10 mL/kg) intraperitoneally (ip). Endotoxin and ketamine were diluted with normal saline at different concentrations so as to inject them into the rats at the same volume (10 mL/kg ). After 1, 4 or 6 h, animals were killed, and tissues from the intestine was removed and kept in liquid nitrogen for later use. We used six rats in every time point of each group.

Electrophoretic mobility shift assay (EMSA)
Nuclear extracts of the intestine tissue was prepared by hypotonic lysis followed by high salt extraction^[20-22]. EMSA was performed using a commercial kit (Gel Shift Assay System; Promega, Madison, WI) as previously described. The NF-kappa B oligonucleotide probe, (5’-AGTTGAGGGGACT TTCCCAGGC-3’), was end-labeled with [g-³²P] ATP (Free Biotech, Beijing, China) with T4-polynucleotide kinase. Nuclear protein (80 mg) was preincubated in 9 mL of a binding buffer, consisting of 10 mmol/L Tris-Cl, pH 7.5, 1 mmol/L MgCl₂, 50 mmol/L NaCl, 0.5 mmol/L EDTA, 0.5 mmol/L DTT, 40 mL/L glycerol, and 0.05 g/L of poly-(deoxyinosinic deoxycytidylic acid) for 15 min at room temperature. After addition of the 1 mL ³²P-labeled oligonuleotide probe, the incubation was continued for 30 min at room temperature. Reaction was stopped by adding 1 mL of gel loading buffer, and the mixture was subjected to non-denaturing 40 g/L  polyacrylamide gel electrophoresis in 0.5×TBE buffer. The gel was vacuum-dried and exposed to X-ray film (Fuji Hyperfilm) at -70 °C .

Reverse-transcription polymerase chain reaction (RT-PCR)
Total RNA was extracted with TriPure Isolation Reagent (Roche Molecular Biochemicals, Switzerland) and quantified by absorption at 260 nm. Reverse-transcription (RT) was implemented using Reverse Transcription System (Promega, WI, USA) according to the protocol. We used glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as normalization control. The sequences of the primers were: TNF-a (sense) CACCACGCTCTTCTGTCTACTGAAC, (antisense) CCGGACTCCGTGATGTCTAAGTACT; IL-6 (sense) GACTGATGTTGTTGACAGCCACTGC, (antisense) TAGCC ACTCCTTCTGTGACTCTAACT; GAPDH (sense) CACGGCAAGTTCAATGGCACA, (antisense) GAATTGTGAGGGAGAGTGCTC. A total volume of 100 mL reaction contained 2 mL of RT product, 1.5 mmol/L MgCl₂, 2.5 U Taq DNA polymerase, 100 mmol/LdNTP, 0.1 mmol/L primer and 1×Taq DNA polymerase magnesium-free buffer (Promega, WI, USA). Then the reaction mixture was overlaid with two drops of mineral oil (Sigma Chemical Co., USA) and incubated in thermocycler (MiniCycler PTC 150, MJ Research Inc, USA) programmed to pre-denature at 95 °C for 2 min, denatured at 95 °C for 1 min, annealed at 60 °C for 1 min and extended at 72 °C for 2 min for a total of 30 cycles. The last cycle was followed by a final incubation at 72 °C for 5 min and cooled to 4 °C . The polymerase chain reaction products were 546 bp (TNF-a), 509 bp (IL-6) and 970 bp (GAPDH) respectively. Then they were electrophoresed on a 15 g/L agarose gel stained with ethidium bromide. The gel was captured as a digital image and analyzed using Scion Image software (Maryland, USA). Values in each sample were normalized with GAPDH control.

Enzyme-linked immunoadsordent assay (ELISA)
TNF-a and IL-6 in the intestine were measured using commercially available enzyme-linked immunoassay kits (Diaclone USA for TNF-a; Biosource USA for IL-6) according to the test protocol. Values were expressed as pg per milligram protein (pg/mg prot).

Statistics and presentation of data
Data were expressed as mean±SE. Statistical significance was determined by one-way ANOVA using SPSS 10.0. A value of P<0.05 was considered significant.

RESULTS
NF-kappa B activation in the intestine
EMSA experiments were performed to examine the effect of ketamine on the activation of NF-kappa B induced by endotoxin. As shown in Figure 1, NF-kappa B activation in the intestine was increased after endotoxin challenge as compared with unstimulated group. The activity of NF-kappa B was in a time dependant manner after endotoxin injection. Ketamine inhibited NF-kappa B activation at three (0.5, 5, and 50 mg/kg) dosing levels (P<0.05, as compared with endotoxin group) (Figure 1).

Figure 1(PDF) Activation of NF-kappa B in the intestine. Normal saline treatment (Lane 1). 1, 4, 6 h after endotoxin challenge (Lane 2, 3, 4), endotoxin plus ketamine (0.5, 5, 50 mg.kg^-1) (Lane 5, 6, 7), ketamine only (50 mg.kg^-1) (Lane 8) ^aP<0.05 vs Lane 1; ^bP<0.01 vs Lane 1; ^dP<0.01 vs Lane 2.
Figure 2(PDF) Expression of TNF-a in the intestine. Normal saline treatment (Lane 1). 1, 4, 6 h after endotoxin challenge (Lane 2, 3, 4), endotoxin plus ketamine (0.5, 5, 50 mg.kg^-1.) (Lane 5, 6, 7), ketamine only (50 mg.kg^-1) (Lane 8); ^bP<0.01 vs Lane 1; ^dP <0.01 vs Lane 2.

TNF-a mRNA expression by endotoxin challenge and the protective effect of ketamine
TNF-a sustained a baseline level in normal rats. Endotoxin caused a transient elevation of TNF-a mRNA in the intestine. This activity increased with time reaching a maximum 1 h after sepsis. Ketamine was administered intraperitoneally soon after endotoxin challenge. TNF-a gene expression was analyzed 1 h later since TNF-a could reach the maximum level about 1 h later. Ketamine suppressed TNF-a expression in a dose dependent manner. We found that ketamine at a dose of 0.5 mg/kg could suppress TNF-a expression significantly. This dosage was far below clinical anesthetic level (Figure 2).

Figure 3(PDF) Expression of IL-6 in the intestine. Normal saline treatment (Lane 1). 1, 4, 6 h after endotoxin only (Lane 2, 3, 4), endotoxin plus ketamine (0.5, 5, 50 mg/kg) (Lane 5, 6, 7), ketamine only (50 mg/kg) (Lane 8); ^bP<0.01 vs Lane 1; ^cP<0.05 vs Lane 3.
Figure 4(PDF) Protective effect of ketamine on the TNF-a production in the intestine. All of the values were obtained 1 h after sepsis. Lane 1 normal saline; Lane 2 endotoxin (5 mg/kg); Lane 3 endotoxin (5 mg/kg) plus ketamine (0.5 mg/kg); Lane 4 endotoxin (5 mg/kg) plus ketamine (5 mg/kg); Lane 5 endotoxin (5 mg/kg) plus ketamine (50 mg/kg); Lane 6 ketamine only (50 mg/kg) ^bP<0.01 vs Lane 2.
Figure 5(PDF) Protective effect of ketamine on the IL-6 production in the intestine. All of the values were obtained 4 h after sepsis. Lane 1 normal saline; Lane 2 endotoxin (5 mg/kg); Lane 3 endotoxin (5 mg/kg) plus ketamine (0.5 mg/kg); Lane 4 endotoxin (5 mg/kg) plus ketamine (5 mg/kg); Lane 5 endotoxin (5 mg/kg) plus ketamine (50 mg/kg); Lane 6 ketamine only (50 mg/kg) ^bP<0.01 vs Lane 2.

IL-6 expression in intestine by endotoxin challenge and the protective effect of ketamine
The IL-6 expression of the small intestine is shown in Figure 3. Endotoxin also enhanced IL-6 expression in the intestine. However the peak time was 4 h after endotoxin challenge. We observed the protective effect of ketamine at this peak time. Ketamine suppressed IL-6 expression in a dose dependent manner. Unlike TNF-a, the minimal dosage at which ketamine could suppress IL-6 significantly was 5 mg/kg. This was within clinical anesthetic range (Figure 3).

Effect of ketamine on TNF-a and IL-6 production in intestine homogenates after endotoxin stimulation
Ketamine suppressed endotoxin-induced TNF-a and IL-6 production in a dose dependent manner. Ketamine beyond the concentration of 0.5 mg/kg could inhibit TNF-a production, however the minimal dosage at which ketamine suppressed IL-6 significantly was 5 mg/kg. This was within clinical anesthetic range (Figures 4 and 5).

DISCUSSION
Our laboratory and others have demonstrated that ketamine could suppress endotoxin-induced some proinflammatory cytokines in vitro^[23]. However it is to be determined in complex in vitro studies. We assessed the cytokines and transcriptional factor NF-kappa B in the intestine because of the important status of the intestine in sepsis or systemic inflammation reaction syndrome (SIRS). The intestine was not only the passive organs injured by sepsis but participation in the pathogenesis of SIRS^[5,6].
      TNF-a is regarded as the most important proinflammatory cytokine, which is released early after an inflammatory stimulus^[24]. And IL-6, which is elevated after TNF-a, contributes to both morbidity and mortality in conditions of “uncontrolled” inflammation^[25]. Among the cytokines produced in the intestinal mucosa during inflammation, TNF-a and IL-6 are particularly important because of its multiple biological effects both in the intestine and in other organs and tissues. In this study, we demonstrated that ketamine suppressed both endotoxin-induced TNF-a and IL-6 expression and production in the intestine. TNF-awas the first cytokine expressed after endotoxin stimulation and later IL-6, which was consistent with several previous reports^[24,25]. Studies had demonstrated that ketamine could suppress endotoxin-induced cytokines in vitro. However, proinflammatory cytokines just like TNF-a and IL-6 were not merely stimulated by endotoxin in vitro. Therefore, our experimental protocol was more physiological and closer to clinical condition.
       NF-kappa B is associated in the cytoplasm with its inhibitory subunit, inhibitory kappa B (IkB), which prevents NF-kappa B from translocating into the nucleus. Endotoxin can induce the phosphorylation and degradation of IkB. Many effector genes including those encoding cytokines (TNF-a and IL-6) are in turn regulated by NF-kappa B^[26]. To determine whether ketamine could inhibit NF-kappa B activation, we did EMSA to detect NF-kappa B activity in the intestine. We found a constitutive activation of NF-kappa B in intestine. Endotoxin could enhance NF-kappa B activation in the intestine and it was most significant 1 h later. Although we had previously demonstrated that ketamine could inhibit NF-kappa B activation in peripheral blood mononuclear cell (PBMC) after endotoxin challenge in vitro. It was to be studied whether ketamine had this effect in vitro. In our experiment, we found ketamine could inhibit NF-kappa B activation. However it was not in a dose dependent manner. We did not found any NF-kappa B activity changes in the group administered ketamine (50 mg/kg ) only, which excluded ketamine itself had any effect on NF-kappa B activity.
    As the rats were not anesthetized during the whole experiment, we did not monitor the arterial pressure and pulse rate to confirm septic shock. Because the drug studied in our investigation was ketamine, just an anesthetic drug. To exclude any other anesthetic drug disturbance, we had to give up that monitoring. However, this septic model was successfully used in many other researches^[27-29]. In addition, we did find that the rats were dispirited with piloerection and diarrhea, which indicated the septic shock indirectly.
      The dosage of ketamine used in this study was from 0.5 to 50 mg/kg, which covered the clinical range. Roytblat et al.^[30] reported that a single dose of ketamine 0.25 mg/kg administered before cardiopulmonary bypass suppressed the increase in serum IL-6 during and after coronary artery bypass surgery. However, other studies demonstrated such a small dose of ketamine did not suppress IL-6 production^[25]. The reason was not clear. In this study, only ketamine reaching a dose of 5 mg/kg could suppress IL-6 production in the intestine. There were perhaps some differences between human being and animals or between in vitro and in vitro studies. We found 0.5 mg/kg  ketamine suppressed TNF-a production, which was in accordance with those in vitro studies^[25].
     In conclusion, we demonstrated that ketamine could suppress endotoxin-induced TNF-a and IL-6 expression and production in the intestine. And this suppressive effect might act through inhibiting NF-kappa B. Further study is required to elucidate the mechanism of ketamine action.

ACKNOWLEDGEMENT
We thank Dr. Genbao Feng for his technical assistance.

REFERENCES
1    Opal SM, Cohen J. Clinical Gram-positive sepsis: does it fundamentally differ from Gram-negative bacterial sepsis? Crit
      Care Med 1999; 27: 1608-1616
2    Rietschel ET, Brade H, Holst O, Brade L, Muller-Loennies S, Mamat U, Zahringer U, Beckmann F, Seydel U, Brandenburg 
      K, Ulmer AJ, Mattern T, Heine H, Schletter J, Loppnow H, Schonbeck U, Flad HD, Hauschildt S, Schade UF, Di Padova F,
      Kusumoto S, Schumann RR. Bacterial endotoxin: chemical constitution, biological recognition, host response, and
      immunological detoxification. Curr Topics Microbiol Immunol 1996; 216: 39-81
3    Wenzel RP, Pinsky MR, Ulevitch RJ, Young L. Current understanding of sepsis. Clin Inf Dis 1995; 22: 407-412
4    Huemann D, Glauser MP, Calandra T. Molecular basis of host-pathogen interaction in septic shock. Curr Opin Microbiol
      1998; 1:  49-55
5    Huang L, Tan X, Crawford SE, Hsueh W. Platelet-activating factor and endotoxin induce tumor necrosis factor gene
      expression in rat intestine and liver. Immunology 1994; 83: 65-69
6    Meyer TA, Wang J, Tiao GM, Ogle CK, Fischer JE, Hasselgren PO. Sepsis and endotoxemia stimulate interleukin-6
      production. Surgery 1995; 118: 336-342
7    Magnotti LJ, Xu DZ, Lu Q, Deitch EA. Gut-derived mesenteric lymph but not portal blood increases endothelial cell
      permeability and promotes lung injury after hemorrhagic shock. Ann Surg 1998; 228: 518-527
8    Sambol JT, Xu DZ, Adams CA, Magnotti LJ, Deitch EA. Mesenteric lymph duct ligation provides long term protection
      against hemorrhagic shock-induced lung injury. Shock 2000; 14: 416-419
9    Langkamp-Henken B, Donovan TB, Pate LM, Maull CD, Kudsk KA. Increased intestinal permeability following shock and
      penetrating trauma. Crit Care Med 1995; 23: 660-664
10  Swank GM, Deitch EA. Role of the gut in multiple organ failure: bacterial translocation and permeability changes. World 
      J Surg 1996; 21: 411-417
11  Lippmann M, Appel PL, Mok MS, Shoemaker WC. Sequential cardiorespiratory patterns of anesthetic induction with
      ketamine in critically ill patients. Crit Care Med 1983; 11: 730 -734
12  Yli-Hankala A, Kirvela M, Randell T, Lindgren L. Ketamine anaesthsia in a patient with septic shock. Acta Anaesthsiol 
      Scand 1992; 36: 483-485
13  Takenaka I, Ogata M, Koga K, Matsumoto T, Shigematsu A. Ketamine suppresses endotoxin-induced tumor necrosis 
      factor alpha production in mice. Anesthesiology 1994; 80: 402-408
14  Koga K, Ogata M, Takenaka I, Matsumoto T, Shigematsu A. Ketamine suppresses tumor necrosis factor-a activity and
      mortality in carrageenan-sensitized endotoxin shock model. Circ Shock 1995; 44: 160-168
15  Cavaillon JM, Munoz C, Fitting C, Misset B, Carlet J. Circulating cytokines: the tip of the iceberg? Circ Shock 
      1992; 38: 145-152
16  Beutler BA, Milsark IW, Cerami A. Cachectin/tumor necrosis factor: production, distribution, and metabolic fate in vitro. 
      J Immunol 1985; 135: 3972-3977
17  Keogh C, Fong Y, Marano MA, Seniuk S, He W, Barber A, Minei JP, Felsen D, Lowry SF, Moldawer LL. Identification of 
      a novel tumor necrosis factor alpha/cachectin from the livers of burned and infected rats. Arch Surg 1990; 125: 79-84
18  Baldwin AS Jr. The NF-kB and IkB proteins: new discoveries and insights. Ann Rev Immunol 1996; 14: 649-683
19  Yu Y, Zhou Z, Xu J, Liu Z, Wang Y. Ketamine reduces NF kappa B activation and TNF alpha production in rat mononuclear
      cells induced by lipopolysaccharide in vitro. Ann Clin Lab Sci 2002; 32: 292-298
20  Gong JP, Liu CA, Wu CX, Li SW, Shi YJ, Li XH. Nuclear factor kB activity in patients with acute severe cholangitis. World J
      Gastroenterol 2002; 8: 346-349
21  Zhou W, Jiang ZW, Tian J, Jiang J, Li N, Li JS. Role of NF-kB and cytokine in experimental cancer cachexia. World J
      Gastroenterol 2003; 9: 1567-1570
22  Liu Z, Yu Y, Jiang Y, Li J. Growth hormone increases lung NF-kappaB activation and lung microvascular injury induced by
      lipopolysaccharide in rats. Ann Clin Lab Sci 2002; 32: 164-170
23  Kawasaki T, Ogata M, Kawasaki C, Ogata J, Inoue Y, Shigematsu A. Ketamine suppresses proinflammatory cytokine
      production in human whole blood in vitro. Anesth Analg 1999; 89: 665-669
24  Hesse DG, Tracey KJ, Fong Y, Manogue KR, Palladino MA Jr, Cerami A, Shires GT, Lowry SF. Cytokine appearance in
      human endotoxemia and primate bacteremia. Surg Gynecol Obstet 1988; 166: 147-153
25  Damas P, Ledoux D, Nys M, Vrindts Y, Groote D, Franchimont P, Lamy M. Cytokine serum level during severe sepsis in
      human: IL-6 as a marker of severity. Ann Surg 1992; 215: 356-362
26  Baeuerle PA, Baltimore D. NF-kappa B: ten years after. Cell 1996; 87: 13-20
27  Arya R, Grossie VB Jr, Weisbrodt NW, Lai M, Mailman D, Moody F. Temporal expression of tumor necrosis factor-a and
      nitric oxide synthase 2 in rat small intestine after endotoxin. Dig Dis Sci 2000; 45: 744-749
28  Secchi A, Ortanderl JM, Schmidt W, Walther A, Gebhard MM, Martin E, Schmidt H. Effects of dobutamine and 
      dopexamine on hepatic micro- and macrocirculation during experimental endotoxemia: an intravital microscopic study 
      in the rat. Crit Care Med 2001; 29: 597-600
29  Taniguchi T, Shibata K, Yamamoto K. Ketamine inhibits endotoxin-induced Shock in Rats. Anesthesiology 
      2001; 95: 928-932
30  Roytblat L, Talmor D, Rachinsky M, Greemberg L, Pekar A, Appelbaum A, Gurman GM, Shapira Y, Duvdenani A. Ketamine
      attenuates the interleukin-6 response after cardiopulmonary bypass. Anesth Analg 1998; 87: 266-271

   Edited by Zhang JZ and Xu FM  

Reviews	Add
more>>